Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
Mohd Golam Quader Khan
Department of Fisheries Biology and Genetics, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh

David J Penman
Institute of Aquaculture, University of Stirling, Stirling FK9 4LA, Scotland, UK

Brendan J McAndrew
Institute of Aquaculture, University of Stirling, Stirling FK9 4LA, Scotland, UK

Sex determination in the Nile tilapia Oreochromis niloticus is more complex than a simple XX-XY sex determining mechanism, as evidenced from fairly frequent unexpected sex ratios in progeny. The production of uniform, homozygous experimental material is particularly advantageous for studying sex determining mechanism as well as for the genetic mapping and genome sequencing studies in which interpretations are facilitated by homozygosity. To better understand the genetic mechanism of sex determination, a fully inbred line of clonal females (XX) was verified in controlled environmental conditions using test crosses and microsatellite DNA markers from the tilapia linkage map. A total of successfully amplified 87 microsatellite DNA markers covering all 24 linkage groups were selected for screening sexually mature females from this line. 67 markers were found polymorphic in outbred individuals screened. Markers from LG1, LG3 and LG23 were given more emphasis because sex determining genes have been mapped on these LGs in different species of tilapia. The verification and validation of this clonal line of females made them an important resource to use as a ‘standard reference line’ in genomics, sex determination studies and other studies in Nile tilapia.

  Clonal line, Microsatellite marker, Sex, Nile tilapia, Oreochromis niloticus
  Tropical Aquarium Facilities, Institute of Aquaculture, University of Stirling
  
  
  Animal Health and Management
  Tilapia

1. To verify fully inbred females of a clonal line (previously developed by gynogenesis) using microsatellite DNA markers from across the tilapia genome.

2. To validate the line as a reference line for studies on sex determination of Nile tilapia.

3. To screen for marker homozygosity at loci across the genome and obsere the progeny sex ratio clonal line females x clonal neo males.

Fish Stock - A number of fully inbred clonal lines of O. niloticus were produced previously by gynogenesis. Many of these showed low fertility. One XX line that showed good fertility was maintained in the Tropical Aquarium Facilities, Institute of Aquaculture, University of Stirling and the line advanced through breeding of clonal females and clonal neomales (the latter produced by hormonal masculinisation). Six sexually mature females from this inbred line were selected for the study. Each of the females was tagged with a passive integrated transponder (PIT) tag and kept in a glass tank. Six outbred females were also reared to be used for comparison of sex ratios with clonal females for a range of males. The basic maintenance of the experimental stock rigorously followed working procedures under ASPA and monitored by the Home Office in the United Kingdom. DNA extraction and quantification - DNA was extracted from fin clips using the REAL kit method (REAL laboratory, Spain) and quantified with a Nanodrop spectrophotometer (Thermo Fisher Scientific, USA). Selection of DNA markers - DNA markers were selected from the tilapia linkage map. Markers were chosen to be approximately evenly spaced from each linkage group to cover the whole genome. A total of 93 microsatellite DNA markers covering all 24 LGs were selected for this study. The number of markers per LG ranges from one to six depending on the size of LG. Markers from LG1, LG3 and LG23 were given more emphasis in selection criteria (n=26) because sex determining genes have been mapped on these LGs in different species of tilapia. DNA amplification - Polymerase chain reaction of the quantified DNA from clonal females was carried out in 15 μl reaction mixtures, using three different “tailed” fluorescent primers to label the PCR products. The components used for a single reaction mixture are 1X Reaction buffer, 1.5 mM MgCl2, 0.2 mM of dNTPs, 0.3 μM Labeled primer, 0.3 μM FW/RV primer, 0.02μM Tailed primer, 0.05U/μl and 0.05μg to 1 μg template DNA. The thermocycler conditions varied for the different fluorescent primers: M13 blue (ggataacaatttcacacagg), CAG tag green (cagtcgggcgtcatca) and Godde black (catcgctgattcgcacat). The forward and reverse sequences of the primers were retrieved from the NCBI databank and any one of the three fluorescent sequences (blue or green or black) was added at 5’ end of either the forward or of the reverse primer, thus that primer was the ‘tailed’ primer. The annealing temperatures for markers from LG1, LG3 and LG23 were determined from saltadjusted and base stacking melting temperatures and used in PCR with some modifications. PCR was performed at 95ºC for 14 min followed by 40 cycles of 95ºC for 1 min, one or two-step annealing temperatures  for markers from LG1, 3 and 23, 72ºC for 1 min, with a final elongation step of 72 ºC for 30 min. For the rest of the markers, annealing temperatures of 57oC, 58oC and 60oC were used for tailed primers having M13 blue, CAG tag green and Godde black, respectively. Genotyping and fragment analyses - The labeled PCR fragments were genotyped using the CEQTM 8800 capillary sequencer to observe the specific allele makeup of the individuals with reference to a specific character (i.e., sex) under consideration. For each capillary run, 0.9 μl product of single PCR reaction was added into a 96 well sequencer plate (Beckman Coulter®,USA) containing 30 μl SLS (Sample Loading Solution) and 0.25 μl DNA Size Standard kit-400 (SS400, Beckman Coulter®,USA) containing fragments labeled with D1-red dye. One drop of mineral oil was added on the top of each sample. An electrophoresis buffer tray, 96 well plate with flat bottom (Beckman Coulter®, USA), was prepared. Each row of 8 samples ran for 45 min using Beckman Frag-3 genotyping method. Evaluation of sex ratios between clonal females and sex-reversed neomales - Once the clonal nature of the females was determined, sex ratios were observed in crosses between females and neomales (hormonally masculinized XX individuals) within this line. A total of 8 crosses were performed, four neomales each crossed to two females, with six different females involved. The survival rates in clonal line progeny were also compared with those in outbred groups on day 11, after the completion of yolk sac absorption period.

  Res. Agric., Livest. Fish., Vol. 1, No. 1, December 2014: 147-158; ISSN : P-2409-0603, E-2409-9325
  
Funding Source:
  

The homozygous nature of the clonal line females in this study with good number of microsatellite markers, the yield of very close to 100% female progeny with sex-reversed neomales suggests that this line of clonal females could be used as standard, ‘reference line’ for genomics, sex determination and other studies in Nile tilapia.

  Journal
  


Copyright © 2025. Bangladesh Agricultural Research Council.