Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Prevalence of Cryptosporidiosis in Crossbred Calves in Two Selected Areas of Bangladesh

A. Khair
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh- 2202, Bangladesh

M. M. Alam
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh- 2202, Bangladesh

A. K. M. A. Rahman
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh- 2202, Bangladesh

M. Shahiduzzaman
Department of Parasitology, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh- 2202, Bangladesh

M. S. Parvez
Department of Microbiology and Hygiene, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh- 2202, Bangladesh

E. H. Chowdhury
Department of Pathology, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh- 2202, Bangladesh

Abstract/ Executive Summary:

A cross-sectional study was conducted to determine the prevalence of bovine cryptosporidiosis using 110 fecal samples of crossbred diarrhoeic calves from two different areas (Muktagacha, Mymensingh and Shajadpur, Sirajgonj) in Bangladesh during April 2012 to September 2014. The fecal samples were screened by rapid detection kit and confirmed by Modified Ziehl- Neelsen staining, and polymerase chain reaction (PCR). The positive samples along with standard positive control yielded 1325bp band on PCR. The overall prevalence of cryptosporidiosis in crossbred calves was 28.18% (31/110) by rapid detection kit. The higher prevalence of cryptosporidiosis was found in the calves from Shajadpur (29.76%) than the calves from Muktagacha (23.08%).The prevalence of cryptosporidiosis was significantly (p<0.001) higher in calves between 1-2 months (70%) age group than less than one month age group (24.49%). Cryptosporidiosis was not observed in calves over two months age. The prevalence of cryptosporidiosis was higher in males (34.75%) than females (24.64%) although not significant statistically. It is evident that the prevalence of cryptosporidiosis in bovine in these areas is under diagnosed and the clinical status of infection is potentially high.

Keywords: Cryptosporidiosis, Prevalence, Calves, Oocysts

Location: Shahjadpur Upazilla of Sirajgonj District and Muktagacha Upazilla of Mymensingh District in Bangladesh

Start Date: 00-04-2012

End Date: 00-09-2014

Program Area: Animal Health and Management

Commodity: Diseases

Objectives:

To describes the prevalence of cryptosporidiosis in crossbred calves under large and small holder dairy farms in some selected areas of Bangladesh.

Methodology:

Study areas, period and population

Five hundred (500) farms having at least two cross-bred dairy cattle were selected conveniently. Calves from day old to 1 year of age were included in this study. Active monitoring and surveillance system was used to collect sample from.

Faecal sample collection and examination

A total of 110 faecal samples from diarrhoeic calves of research area (Muktagacha and Shajadpur) were collected and examined for the presence of Cryptosporidium. Fecal samples were collected directly from the rectum of the animals or from the faecal mass immediately after defecation in stool pot with detail history of age group and sex and were immediately capped, labeled accordingly which included sample identification and site of collection. The collected samples were placed on ice in an insulated container in order to maintain low temperature of the samples. Feces were transported to the Laboratory of Department of Medicine, Bangladesh Agriculture University, Mymensingh and processed within 1–3 days of collection. The samples were examined in the field and in the Laboratory soon after collection or after preservation by freezing at -20⁰C. In this study, stool samples collected from diarrheic calves were tested by rapid detection kit (Rainbow Calf scour 5, BioX Diagnostics, Belgium) to detect Cryptosporidium and other enteropathogens from diarrheal fecal samples as per manufacturer’s instruction. A total of 4 representative samples from 31 positive for cryptosporidiosis by BioK-306 were mixed together and a thin smear was prepared and stained using a modified Ziehl-Neelsen method for further confirmation of Cryptosporidium spp. Samples were treated with carbol-fuchsin solution for 3 minutes. The discoloration procedure was realized with discoloration solution (95% ethyl alcohol-50ml and 95% Acetone-50ml) for 15-20 seconds used instead of the ethyl alcohol-sulfuric acid 5%. These modifications promoted a better washing out of the excess of carbol fuchsin therefore increasing the dye efficiency. In such conditions, the visualization of protozoan oocysts on the slides examined became easier. Smears were washed with running water and counterstained with solution of 0.4% malachite green or methylen blue at 1% for 1 minute. After the final wash with water, slides were dried at room temperature and then examined using X40 and X100 magnification under microscope. The positive samples were stored at -20°C for DNA extraction.

DNA Extraction

DNA was extracted from concentrated mixture of 4 positive samples. Cryptosporidium oocysts were purified using a NaCl flotation procedure. Purified oocysts were washed three times in DDW/PBS in 50ml tube. After wash, the sediment was re-suspended with 45ml saturated salt solution. Five milliliter DDW was layered above the re-suspended samples. Samples were then centrifuged at 2300rpm for 30 minutes without break. Cryptosporidium oocysts were deposited in the upper layer and were collected and transferred to another tube by pipette. The oocysts were then subjected to 5-8 freeze-thaw cycles and DNA extraction was carried out using a Promega DNA extraction kit according to the manufacturer’s instructions. The DNA extracted from the concentrated oocyst was used for polymerase chain reaction (PCR). The amplified products obtained from PCR assay were visualized after running through agarose gel electrophoresis.

Cryptosporidium detection by PCR

Cryptosporidium oocysts were confirmed by polymerase chain reaction (PCR). Primary PCR was performed by primers SSU-F2: (5 TTCTAGAGCTAATACATGCG 3) and SSU-R2: (5’-CCCATTTCCTTCGAAACAGGA 3). primary PCR mixtures contained 5μl of template, 2X PCR Master mix (Promega, USA)-12.5μl, 1μl of each primer (10 pmol/μl) and DDW-5.5μl in a 25μl reaction volume. Thermocycling parameters were 3 minutes at 94°C hot start (initial heat activation step), followed by 35 cycles of 45 seconds at 94°C, 45 seconds at 55°C and 1 minute at 72°C, with a final extension of 7 minutes at 72°C. The PCR product was loaded on 1.5% agarose gel, electrophoresis was done for 1 hour. The gel was stained with ethidium bromide and the products (1325bp) were visualized under a UV transilluminator. Statistical analysis The association of cryptosporidiosis with other variable like area, age and sex were assessed by Chi-square test. The Chi-square test and 95% confidence interval of prevalence were performed in R 3.1.0 (The R foundation for Statistical Computing).

Source of Information: Bangl. J. Vet. Med. (2014). 12 (2): 185-190

Article Link (Online Journal):

Funding Source:

Total Budget (Tk.) :

Achievement/Findings:

Results of this study indicate that the prevalence of cryptosporidiosis in crossbred calves in these areas is under diagnosed and the clinical status of infection is potentially high. The prevalence of the Cryptosporidium species/genotypes appeared to be age related. Because calves less than 3 months of age are the predominant population infected with C. parvum (zoonotic species), any effort designed to control this infection must be directed primarily at this age group. A further prospective study, capturing seasonal variations to elucidate the magnitude of the disease (mortalities and reduced production), is desirable. Moreover, studies to understand the dynamics of transmission cycles and the genetic diversity of Cryptosporidium spp. on the farms should be undertaken.

Knowledge Management: Journal