Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
Md. Faruque Miah
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Fahmida Haque
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Mohammad Robin Mia
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Enaya Jannat
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Hafij Ali
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

M. M. A. Quddus
Department of Zoology, University of Dhaka, Bangladesh

Kawser Ahmed
Department of Oceanography, University of Dhaka, Bangladesh

This study was carried out for molecular identification and sexual differentiation of freshwater mud eel, Monopterus cuchia which is most important for induced breeding. Traditional classification of freshwater eels has always been obscurerd and unreliable due to their morphological ambiguity. A rapid and cost effective molecular markers, mitochondrial 16S rRNA and glutamine synthetase gene was used to establish molecular standards for identification of this fish. Similar bands were seen in all the individuals at the level of 250bp length by using 16s mitochondrial DNA of 24 individuals and 544bp length for partial sequence of glutamine synthetage gene in 11 individuals. A successful protocol was developed to identify male and female M. cuchia through morphological, anatomical and histological analysis.

  16s Mt NA, Gsase Gene, Molecular Identification, Sexual Differentiation, Monopterus Cuchia
  Genetic Engineering and Biotechnology at Shahjalal University of Science and Technology, Sylhet
  
  
  Variety and Species
  Eel
  1. To study the identification and sexual differentiation of freshwater Mud Eel, Monopterus cuchia.

Collection of Fish: Fish samples were collected by fisherman from “Tanguar Haour”, Sunamganj and then identified through morphological characteristics. Collected fish samples were brought to the laboratory of Genetic Engineering and Biotechnology at Shahjalal University of Science and Technology, Sylhet, Bangladesh and were kept into glass aquariums until tissue isolation for molecular and histological analysis as well as for studying external and internal anatomy. Molecular Identification: DNA extraction Each fish was dissected and different tissue samples (i.e. liver, kidney etc.) were isolated and washed with distilled water and 70% alcohol. Then, the tissues were preserved separately in 100% alcohol at -20oC. DNA extraction was carried out by using a commercially available kit, Bioserve, CAT.NO.2025. A total of 24 fish samples were used for DNA extraction and extracted DNA samples were stored at -20ºc. The quality of DNA was checked by electrophoresis on 0.8% agarose gel comparing with 30bp long lamda DNA. The gel was run at 70 V for 40 minutes dying with ethedium bromide solution. Finally, photographs were taken by digital camera using gel documentation system. PCR amplification: Vertebrate universal primer, accession no. 16SrRNA L2513 (5’ GCCTGTTTACCAAAAACATCAC 3’) and accession no. 16SrRNAH2714 (5’ CTCCATAGGGTCT TCTCGTCTT 3’) as well as gene specific primer of glutamine synthetase, accession no. GSase 152041 (5’ GAGGGCTCCAACAGCGATATGTA 3’) and accession no. GSase 152042 (5’ CTGAAGTTTGTATGGCAGCC AGC 3’) were used to identify the species. PCR reaction was done for both the primers with 25μl of master mix for each sample. In this experiment PCR reaction of 16s mitochondrial DNA was conducted by 40 cycles with preheated at 94ºC for 3 minutes followed by denaturation at 94ºC for 1 minute, annealing at 58ºc for 1 minute and 2 minutes for extension at 72ºC. A final step of 7 min for 72ºC was added to allow complete extension of the amplified fragments. PCR amplification of glutamine synthetage gene was maintained like 16s mtDNA, where denaturation at 94°C for 1 min. and annealing temperature at 640C for 1 min. and run with 35 cycles. Amplified products were stored at -20ºC. The amplified DNA fragments were separated on 1.2% agarose gel for 40 minutes at 70V comparing with 1000 bp ladder. Next, the photographs were taken by a digital camera using gel documentation system. Sexual Differentiation: Male and female were identified by morphological, internal anatomy and histological analysis. Note that, Morphological study was observed by naked eye with important characteristics. Specifically, some measuring parameters were analyzed using measuring scale and lifting balance. Different internal organs especially gonads, liver, kidney and intestine were observed through dissection process. Also, gonad shape, size, length etc. and sperm duct or oviduct was analyzed. Moreover, the number of mature eggs in the oviduct was also counted. We, at the same time, studied the histological analysis of gonads using microtomy.

  Universal Journal of Agricultural Research 1(3): 54-58, 2013
  
Funding Source:
1.   Budget:  
  

Sexual differentiation of this species was established through morphometric and histological analysis for suitable differentiation between male and female fish.

  Journal
  


Copyright © 2026. Bangladesh Agricultural Research Council.