Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
Susmita Sarker
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Abdul Jabber Howlader
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Faria Farhana Rain
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Abu Faiz Md Aslam
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Predatory efficacy of Coccinella transversalis (Coleoptera: Coccinellidae) on three detrimental agriculturally important aphids (Aphis craccivora, A. fabae and A. gossypii) was studied under laboratory condition. The 4th instar larvae of C. transversalis consumed highest (21.56 ± 1.72) number of A. craccivora aphids followed by A. fabae (12.33 ± 1.74) and A. gossypii (13.99 ± 0.77). Life cycle studies of C. transversalis on the above three aphid species revealed that it took maximum (27.66 ± 3.06) days to complete life cycle while reared on A. craccivora followed by A. fabae (25.66 ± 0.58 days) and A. gossypii (22.33 ± 1.52 days) respectively. As C. transversalis is a potential predator, an attempt was taken to identify this biological control agent based on mitochondrial cytochrome c oxidase (COI) gene sequence. Sequenced gene was submitted to the NCBI GenBank database (Accession NO. MG 587947.1) followed by proper procedure. Phylogenetic relationship of the beetle was constructed based on mitochondrial COI gene. The nucleotide composition analysis revealed that the value of A+T (69.3%) was greater than G+C (30.7%). Such study of C. transversalis would be helpful in biological control programme of aphid pest.

  Coccinella transversalis, Predatory efficacy, DNA barcode, Molecular Identification
  Experimental Station, Department of Zoology, Jahangirnagar University
  
  
  Pest Management
  Insects

To identify this biological control agent based on mitochondrial cytochrome coxidase (COI) gene sequence.

The predatory efficacy of larval stages of Coccinella transversalis were tested on three agriculturally important aphid species i.e. Aphis craccivora, A. fabae and A. gossypii separately under controlled conditions (26 ± 2ºC and 65 ± 5% RH). To maintain a regular supply of the aphid and beetle population, a garden of bean, Lablab purpureus and brinjal plants, Solanum melongena were maintained at the Insect Rearing and Experimental Station, Department of Zoology, Jahangirnagar University. To investigate the predatory efficacy of larvae of the predator against aphids, newly hatched larvae of the predator were placed singly in six Petri dishes having a Whatman filter paper. A counted number of aphids (30) were provided in each Petri dish daily. Upper collar portion of the Petri dishes was treated with vaseline and covered with muslin cloth to avoid larval escape. Everyday, old leaves were substituted with new ones and unconsumed numbers of aphids were noted. The predation potential of larvae of the predator was investigated by feeding the grubs on aphids. The number of aphids consumed per day, during the period of study was recorded in each treatment by counting the number of remaining aphids and subtracting them from the total number of aphids provided. The larvae of the predator were also checked daily for their moulting to calculate the duration of each larval instar. This practice was continued until pupation. DNA isolation: Coccinella transversalis was collected from the stock culture of Molecular Entomology Laboratory of Jahangirnagar University. The genomic DNA was extracted from somatic tissue rich in mitochondria, e.g., leg or elytra (Levenbook and Williams 1956) using Wizard Genomic DNA Purification Kit, USA, following the manufacturer’s protocol with slight modification as mentioned in Aslam et al. 2019. The remaining parts of insects and respective individuals were kept as voucher specimens. Processed DNA was stored at 40C or − 200C. The quantity and purity of DNA was measured by using Nano drop 2000 spectrophotometer (Thermo Fisher Scientific, USA). 1 µl of nucleic acid was used to quantify nucleic acid. 260/280 Ratio, the ratio of absorbance was used to assess the purity of DNA. A ratio of ~1.8 was generally accepted as “pure” for DNA. The extracted DNA was subjected to PCR amplification through Applied Biosystems Veriti 96-Well Thermal Cycler following standard protocols. Primers used were forward primer: (LCO 1490 5′GGTCAACAAATCATAAAGATATTG G-3′) and reverse primer: (HCO 2198 5′TAAACTTCAGGGTGACCAAAAAATCA-3′). The PromegaGotaq G2 Green Master Mix (Promega Corporation) was used that contained GoTaq G2 DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient amplification of a wide range of DNA templates by PCR. The PCR reaction mixture consisted of total volume 20 µl among that master mix - 10 µl, forward primer - 1 µl (10 picomolar), reverse primer - 1 µl (10 picomolar), template DNA (50 mg),  and adjustable nuclease free water.  Thermocycling consisted of an initial denaturation of 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 49°C for 30 sec, extension at 72°C for 1 min, final extension: 720C for 10 min and hold: 40C.  The chromatograms were converted to FASTA format using FinchTV chromatogram viewer software. The DNA sequences in ABI file were manually edited using BioEdit v.7.0.5. Results of sequence editing were analyzed using BLAST (Basic Local Alignment Search Tool) NCBI to indicate the homology from closest species. Phylogenetic tree was constructed using maximum likelihood method, calculation using Bootstrap with 1000 times of repetition in MEGA (Molecular Evolutionary Genetic Analysis) software program v.10.0. (Tamura et al. 2013). COI gene sequence of five coccinellid beetle (Coccinella transversalis) was also collected from National Centre for Biotechnology Information (NCBI) to compare with the research sample for their phylogenetic analysis.  
 

 

  Bangladesh J. Zool. 47(2): 229-241, 2019
  DOI: https://doi.org/10.3329/bjz.v47i2.44334
Funding Source:
1.   Budget:  
  

The potential role of C. transversalis in bio- control of three detrimental agricultural aphids. However, further field based studies are needed to confirm this hypothesis.

  Journal
  


Copyright © 2026. Bangladesh Agricultural Research Council.