Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
M. A. Rahman
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh. Present: Department of Medicine, Surgery and Obstetrics, Patuakhali Science and Technology University, Babugonj, Barisal, Bangladesh.

A. K. M. A. Rahman
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh.

M. A. Islam
Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh

M. M. Alam
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh.

Food-borne pathogens causing infections and intoxications can affect everyone. Escherichia (E) coli is one of the major food borne bacterial pathogens. This study was conducted to investigate the prevalence of E. coli in milk, chicken meat and beef and to determine the multi-drug resistance profile of E. coli in Mymensingh district, Bangladesh. A total of 169 samples including milk (n=108), chicken meat (n=51) and beef (n=10) were collected from Bangladesh Agricultural University (BAU) dairy farm, American dairy farm, Gazipur and retail markets of municipal area during July 2016 to June 2017. E. coli were isolated and identified by  colony characteristics on selective agar like Eosine-methylene blue (EMB) agar, Salmonella-Shigella (SS) agar, Gram staining, biochemical test and Polymerase Chain Reaction (PCR). The overall prevalence of E. coli in all food samples was 37.86%. A total of 32 (29.63%) milk, 25 (49.02%) chicken meat and 07 (70%) beef samples were E. coli positive through conventional method. Among 64 samples only 23 samples (35.94%) were confirmed by PCR. Multi-drug resistant E. coli were detected by disc diffusion test using 10 commonly used antibiotics. Antibiogram study showed that E. coli isolated from chicken meat were resistant to oxytetracycline (92%), sulphonamide-trimethoprim (84%), amoxycillin (76%) and erythromycin (60%). E. coli isolated from beef sample were resistant to erythromycin (85.71%) and oxytetracycline (71.43%) and sensitive to ciprofloxacin (100%), gentamicin (100%) and neomycin (100%). However, all isolates of E. coli were found sensitive to amikacin (100%). E. coli isolated from milk sample were 100% sensitive to gentamicin followed by neomycin, ciprofloxacin, azithromycin, oxytetracycline and erythromycin. Overall 50% of E. coli isolates of food were found multi-drug resistant. About 28.13%, 57.14% and 76% of the E. coli isolates originated from milk, beef and chicken meat respectively were multi-drug resistant. The higher prevalence of E. coli in chicken meat, beef and milk indicates unhygienic production and processing of these foods. Presence of multi-drug resistant E. coli in these foods might pose serious public health threats. The antibiogram profile of the isolates will help therapeutic decision making in the treatment of colibacillosis in cattle and poultry in Bangladesh.  
 

  E. coli, Milk, Beef and chicken meat, Antibiogram, Multidrug resistance, PCR.
  Mymensingh and Gazipur district of Bangladesh.
  00-07-2016
  00-06-2017
  Pest Management
  Meat, Milk

The objectives of this study were to isolate and identify antimicrobial resistant E. coli from chicken meat, beef and milk samples in Bangladesh. 

Collection of samples: The samples were collected randomly from farms and local markets situated in Mymensingh and Gazipur district of Bangladesh. A total of 169 (51 poultry meat, 10 beef and 80 milk) samples have been tested from July 2016 to June 2017. Aseptically collected meat samples have been placed in sterile plastic bags and then brought to the Medicine laboratory of veterinary science at BAU using icebox. Milk samples have been collected from BAU dairy farm, American dairy farm, Gazipur, surrounding other local farm and market. Aseptically 8-10 ml of milk was collected in test tube directly from teat of lactating cow and local market and send to the Medicine laboratory using icebox. Five to ten grams of chicken breast meat or beef were collected aseptically in zipper bag and send to the laboratory using ice box. Sample preparation: Five to ten grams of meat were mixed with 10 ml of peptone (0.1%) water then homogenized suspension was prepared using sterilized pestle and mortar.  Isolation and identification of E. coli: The homogenized samples were then transferred into nutrient broths (5 ml/test tube), nutrient agar and others specific media (EMB agar and SS agar, Hi-media, India). In every step, samples were incubated at 370C for 24 hours. The positive samples were then subculture several times to be pure culture. Gram staining and Biochemical test (five basic sugars) were done to be confirmed (Cheesbrough, 1985). Antibiotic disc diffusion (CLSI, 2012) test were done for E. coli in Muller- Hinton agar (Hi-Media, India). Polymerase chain reaction (PCR): DNA extractions were performed through boiling method (Hassan et al., 2012). PCR assay were applied in all the 64 isolates to confirm the E. coli. For the detection of E. coli a highly conserved region such as 16S rRNA was targeted. The nucleotide sequence (5’-3’) of the primer ECO-1Foward GACCTCGGTTTAGTTCACAGA and ECO1Reverse- CACACGCTGACGCTGACCA with amplicon size 585 bp (Fratamico et al., 2000) were used. PCR reaction mixture for single sample were 20 μl consisting of RNAse free water 5 μl, PCR master mixture (Thermo Scientific, EU) 10 μl, genomic DNA 3 μl and primer 2 μl. The PCR amplification was done by Initial denaturation at 940C for 3 minutes followed by 35 cycle of denaturation at 940 C for 45 second, annealing at 550C for 45 sec and extension at 720C for 60 secon. The final extension was at720C for7 min. PCR amplify products were subjected to gel (1% agarose, Takara, Japan) electrophoresis with ethidium bromide fluorescence (100 v for 30 minutes) and visualized in gel documentation system via UV transilluminator (302 nm).  Detection of multi-drug resistant E. coli- Antimicrobial sensitivity test:  Antimicrobial susceptibility of E. coli was performed by the disc diffusion test applied on Muller-Hinton agar (Hi-media, India) in vitro using 10 commercially available antibiotics (Oxoid, UK) e. g., oxytetracycline (30μg), ciprofloxacin (5μg), gentamicin (10μg), erythromycin, (15μg), azithromycin (15μg), sulphonamide-trimethoprim (25μg), neomycin (10μg), amoxicillin (10μg), doxycycline (10μg) and amikacin (30μg) according to the guidelines of the CLS1 (2012).

  Bangl. J. Vet. Med. (2017). 15 (2): 141-146 ISSN: 1729-7893 (Print), 2308-0922 (Online)
  
Funding Source:
1.   Budget:  
  

CONCLUSIONS: The higher prevalence of E. coli in milk, chicken meat and beef indicates unhygienic production and processing of these foods. Presence of multi-drug resistant E. coli in these foods may pose serious public health threats. The antibiogram profile of the isolates may help therapeutic decision making in cattle and poultry practice in Bangladesh. Further studies on pathogenicity and detection of antibacterial resistant genes as well as genetic evolution can be performed. 

  Journal
  


Copyright © 2026. Bangladesh Agricultural Research Council.