Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
Alex Gumovsky
Schmalhausen Institute of Zoology, 15 Bogdan Khmelnitsky St., 01601 Kiev MSP, Ukraine. E-mail: gumovsky@izan.kiev.ua

Andrew Polaszek
Dept of Entomology, Natural History Museum, London SW7 5BD U.K. E-mail: a.polaszek@nhm.ac.uk

Sean T. Murphy
CABI Bioscience, Silwood Park, Ascot, Berks SL5 7PY, U.K. E-mail s.murphy@cabi.org

M.F. Rabbi
Bangladesh Rice Research Institute, Gazipur, Dhaka, Bangladesh

Chao-Dong Zhu
Institute of Zoology, Chinese Academy of Sciences, Beijing 100080, China. E-mail: zhucd@ioz.ac.cn

A new species of the genus Closterocerus (Hymenoptera: Eulophidae), Closterocerus oryzamyntor Gumovsky & Zhu sp. nov., is described based on morphological and molecular data. C. oryzamyntor is a larval endoparasitoid of a major pest of rice, Dicladispa armigera (Chrysomelidae: Hispinae). C. oryzamyntor is known so far only from Bangladesh, and only from this host. The species is characterized by the following morphological features: 1) deep sutures on the vertex of the male, connected to form a complete transvertexal suture in the female; 2) a comparatively long malar space, which is 0.3 times as long as the eye height, and 0.7 times as long as the breadth of the mouth; 3) predominantly pale femora, tibiae, tarsi and antennal scape; 4) the comparatively wide scape of the male, 2.6–2.7 times as long as broad; 5) the male pedicel, flagellum, coxae and gaster, which are all dark. Partial gene sequences of the 28S D2 ribosomal region were identical for all individuals sampled, but differed from two Closterocerus sequences on GenBank by 24 and 27 base pairs (about 6%). Both CytB and COI mitochondrial gene fragments demonstrated slight variation within the species, but no other eulophids have been sequenced for these genes, thus comparative data are lacking for these genes.

  28S, Bangladesh, Biological control, Chrysomelidae, Closterocerus, COI, Cytochrome B, Dicladispa armigera, DNA, Eulophidae, gene sequences, hispa, parasitoid wasps, rice
  Bangladesh Rice Research Institute (BRRI), Gazipur, Bangladesh (BRRI)
  
  
  Pest Management
  Insects

The purpose of this paper is therefore to describe a new species of Closterocerus of major economic importance for the biological and integrated control programmes for rice hispa in Southeast Asia, particularly Bangladesh. The following description is based on morphology, but DNA sequence data are also provided for the following genes: Nuclear ribosomal 28S D2, mitochondrial Cytochrome Oxidase I and Cytochrome B.

Rearing and preservation Specimens were collected by setting out rice plants infested with Dicladispa armigera larvae in the field at BRRI, Gazipur. This was done in June through to July, 2002. All ZOOTAXA specimens reared were preserved in 60% ethyl alcohol. Morphological study Morphology was examined using both light and scanning electron microscopy. The latter was undertaken in the Mineralogy Department of the Natural History Museum (London) using an LEO 14S5VP microscope, which allows imaging of uncoated specimens (under the program LEO-32 V04.00.01). General morphology images were taken with a JVC 3-CCD colour video camera KY-F55B with Auto-Montage Pro software (Synoptics U.K. Ltd.). Terms used in the description of the new species generally follow Hansson (1990), in order to facilitate comparison with previously described species. However, some terminology has been adjusted following Gibson et al. (1997). DNA sequencing Genomic DNA was extracted from each individual using a protocol largely based on those described in the DNeasy® Tissue Handbook provided by QIAGEN (www.qiagen.com) and Wizard® SV96 genomic DNA Purification System (www.promega.com). The following pairs of primers were used to amplify three gene fragments: 28S D1 & D2: D1F (ACCCGCTGAATTTAAGCATAT) (Harry et al., 1996) and D2R (TTGGTCCGTGTTTCAAGACGG) (Campbell et al., 2000); COI Jerry & 2613: COI-Jerry (CAACATTTATTTTGATTTTTTGG) and COI-2613 (ATTGCAAATACTGCACCTAT) (Simon et al., 1994); CytB 3 & 4: CB3 (GAGGAGCAACTGTAATTACTAA) and CB4 (AAAAGAAA(AG)TATCATTCAGGTTGAAT) (Barraclough et al. 1999). Standard Polymerase Chain Reactions (PCR) were carried out in 25µl reactions consisting of 2.5µl BIOTAQ 4x NH4 Buffer, 2.625µl 25 mM MgCl2, 0.7µl dNTP, 0.35µl forward and reverse primers, 0.084µl BIOTAQ Taq polymerase and 1–4µl DNA. Various volumes of distilled water were added to make the total volume up to 25 µl for each reaction. Gene fragments were sequenced in both directions.

  Zootaxa 1241: 51–59 (2006) ISSN 1175-5326 (print edition) ISSN 1175-5334 (online edition)
  www.mapress.com/zootaxa/
Funding Source:
1.   Budget:  
  

Preliminary observations have been made on the field biology of Closterocerus oryzamyntor by staff at the Bangladesh Rice Research Institute (BRRI), Gazipur, Bangladesh (BRRI), unpublished report). These observations were reported as being on ‘Neochrysocharis sp.’. C. oryzamyntor appears to be the most common larval parasitoid of D.armigera in Bangladesh. Studies on field parasitism using ‘trap plants’ (using 2nd and 3rd instar D. armigera larvae) indicate that parasitism is low during the December – January period (when the boro rice is being grown), but generally rises in August and September, when the aus rice crop is in the ground. Estimates of parasitism during months and between years is highly variable, but values of over 80% have been recorded. BRRI have also made observations on the life history of the parasitoid by exposing insectary-reared D.armigera to mated female parasitoids, previously reared from naturally parasitized D. armigera. This work has suggested that C. oryzamyntor lays more eggs, proportionally, in 2nd and 3rd instar larvae compared with other instars. The mean longevity of adults fed on a 50% honey solution was 4.3 days; minimum and maximum survival was 3 and 6 days respectively. Also, at about 300 C and 80% RH, the development time, from egg to adult, varied between 8 and 13 days, with a mean of 10.7 days.

  Journal
  


Copyright © 2026. Bangladesh Agricultural Research Council.