Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
MM Rahman
Institute of Tropical Agriculture, Kyushu University, Fukuoka, Japan

S Hosoishi
Institute of Tropical Agriculture, Kyushu University, Fukuoka, Japan

K Ogata
Institute of Tropical Agriculture, Kyushu University, Fukuoka, Japan

The weaver ant species, Oecophylla smaragdina is distributed from India through Southeast Asia to Northern Australia including many tropical Western Pacific Islands. A recent phylogenetic study of O. smaragdina revealed the central Bangladesh population as belonging to the Southeast Asian mainland clade despite of its geographical proximity to India. However, the Bangladeshi analyzed sample was limited to a single site and the geographical border between Indian and Southeast Asian groups has not been presented. In this study, 19 samples collected from western parts of Bangladesh have been used to infer the phylogenetic position. A total of 20 O. smaragdina colonies were sampled from Bangladesh during 2013 to 2014. Their haplotype and phylogenetic relationships were determined by analyzing 2 mitochondrial loci: Cytochrome b (Cytb) consisting of 606 bp and Cytochrome c oxidase subunit I (COI) consisting of 775 bp. Bayesian analysis inferred that the western parts of Bangladesh were occupied by mitochondrial haplotype usually found in India, which is recorded first time in the country. The present study revealed that, both the Indian and Southeast Asian mitochondrial haplotypes were occurred on either side of Ganges river.

  Mitochondrial DNA, Cytb, Geographical distribution, COI, Ganges River.
  19 localities in 12 districts belonging to 4 divisions of Bangladesh
  00-00-2013
  00-00-2014
  Pest Management
  Ant

The goal of the present study is to test whether the western Bangladesh populations of O. smaragdina all belong to the SE Asian clade.

Sampling and preparation of specimens In 2013 to 2014 we collected adult Oecophylla smaragdina workers from 20 colonies at 19 localities in 12 districts belonging to 4 divisions of Bangladesh. The specimens were preserved in 99% ethanol prior to DNA extraction. Molecular studies Genomic DNA was extracted from the fore, middle and hind legs of specimens that were preserved in alcohol by using QIAGEN DNeasy Blood and Tissue kit (Qiagen, Meryland, USA). Amplification of mitochondrial DNA was done by polymerase chain reaction (PCR). The thermal cycling parameters for Cytb and COI basically followed the protocols established by Crozier and Crozier (1993) and Sameshima et al. (1999), including 95 °C for 5 min for initial denaturation, 35 cycles of dissociation (92 °C, 1 min), annealing (50 °C for Cytb and 54 °C for COI, 1 min), and extension (70 °C, 2 min). The primers used for amplification are identical to primers reported by Crozier et al. (1994), Lunt et al. (1996), Azuma et al. (2002), and Azuma et al. (2006). Primers for the Cytb gene fragment were Cb1 (5‘TATGTACTACCATGAGGACAAATATC’3) and tRs (5’TATTTCTTTATTATGTTTTCAAAAC’3). For the COI gene fragment, COI 1-3 (5’ATAATTTTTTTTATAGTTATACC’3) and COI 2-4 (5’TCCTAAAAAATGTTGAGGAAA’3) were used as forward and reverse primers, respectively (Crozier & Crozier, 1993). Illustra and ExoProStar were followed according to the instruction of the manufacturer GE Healtcare. For cycle sequencing, ABI PRISM Big Dye Terminator v3.1 cycle sequencing kits from Applied Biosystems were used in an automated sequencer. Primers for the sequencing reaction were identical to those used in the amplification step. Sequencing reaction was performed by using ABI 3100 Avant DNA Sequencer (Applied Biosystems). For the phylogenetic analysis of western Bangladeshi O. smaragdina populations, 16 samples for Cytb and 19 samples for COI genes have been used with 606 bp and 775 bp, respectively. In addition, in this analysis, sequence data of both COI and Cytb were used from Azuma et al. (2002), Azuma et al. (2006) and Asaka (2010) retrieved from DDBJ GenBank. Sequence data of both COI and Cytb of Oeocophylla longinoda from Cameroon were used as outgroup in this analysis. The sequencing analysis was done by using Vector NTI Advance ver. 11.5 software. Haplotypes of Cytb and COI were aligned by using MEGA 6.0 software (Tamura et al., 2013). Phylogenetic trees inferred from concatenated matrix conducted by Bayesian methods based on MrBayes. For the selection of best- fit model MrModeltest 2.3 was performed with PAUP*4.0 Beta version10. For both mitochondrial COI and Cytb genes, substitution model GTR + I + G with 1,000,000 generations were used.

  Sociobiology 64(4): 437-441 (December, 2017)
  DOI: 10.13102/sociobiology.v64i4.1153
Funding Source:
1.   Budget:  
  

We here confirm that O. smaragdina populations with Indian mitochondrial haplotypes exist in the western part of Bangladesh. The result of present study suggested the importance of comprehensive surveys, also taking into account the central and eastern populations of Bangladeshi O. smaragdina.

  Journal
  


Copyright © 2026. Bangladesh Agricultural Research Council.