Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
Md Sagir Ahmed
Department of Zoology, University of Dhaka, Dhaka1000, Bangladesh

Sujan Kumar Datta
Department of Zoology, Jagannath University, Dhaka1100, Bangladesh

Ayesha Akhter Zhilik
Department of Zoology, University of Dhaka, Dhaka1000, Bangladesh

This study represents the comprehensive molecular identification of freshwater fishes of Bangladesh based on a fragment of the cytochrome c oxidase subunit I (COI) gene in the mitochondrial genome. A total of 315 mitochondrial COI barcode sequences were obtained from 153 species,114 genera, 49 families and 16 orders of fishes. The mean length of the sequences was 652 base pairs. For all the samples, %G was significantly lower compared to the other nucleotides and %GC was lower compared to % AT (p-value ? 0.05). Also, a significantly lower %GC content was observed in second and third codon position compared to the first one in all the samples (1st>2nd>3rd, p-value? 0.05). The average K2P distances within species, genera, families and orders were 0.38%, 7.02%, 12.75% and 18.68%, respectively. The mean interspecific distance was 18-fold higher than the mean intraspecific distance. The K2P neighbor-joining (NJ) trees based on the sequences generally clustered species according to their taxonomic position. A total of 12 species were newly recorded in Bangladesh. High efficiency in species identification were demonstrated in the present study by DNA barcoding, and concluded that COI sequencing can be used as an authentic identification marker for freshwater fish species.

 

  Freshwater fishes, COI, DNA Barcoding, Genetic Diversity, Phylogeny
  Haor, baor, beels, floodplain, fish landing centers, fish markets
  00-07-2014
  00-06-2018
  Variety and Species
  Fish

To the molecular characterization of morphologically identified freshwater species of Bangladesh using partial COI gene sequence.

Study area and specimen collection: Fish samples were collected from rivers, haor, baor, beels, floodplain, fish landing centers, fish markets or from the local fishermen during July 2014 to June 2018. Personal fishing was also conducted to collect some rare and non-commercial fish species whenever necessary. Photographs of all the fishes were taken immediately and taxonomic identification of specimens were done following previous reports (Talwar and Jhingran 1991, Rahman 2005, Siddiqui et al. 2007). Immediately after collecting the specimens, tissue samples were excised and stored in 90% ethanol. Voucher specimens were fixed with 10% formalin and then transferred to 70% ethanol solution for preservation. Voucher specimens were transported to Dhaka and deposited in the Professor Kazi Zaker Hussain Museum at the Department of Zoology, University of Dhaka. DNA barcoding: Genomic DNA was extracted from the muscle tissue samples by the standard Proteinase-K/Phenol-Chloroform-isoamyl alcohol method (Green and Sambrook 2012, Ahmed et al. 2019). The quality and quantity of the extracted DNA was measured using Nanodrop™ spectrophotometer. Approximately 658bp was amplified from the 5′ region of the MT-COI gene using the following primers: FishF1 5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1 5′ TAGACTTCTGGGTGGCCAAAGAATCA3′ only when failed to amplified the FishF2 5′TCGACTAATCATAAAGATATCGGCAC3′ and FishR2 5′ACTTCAGGGTGACCGAAGAATCAGAA3′ were used (Ward et al. 2005). For this, 25 µl PCR reaction mixtures were prepared which included 17.25–18.75 µl of ultrapure water, 2.5 µl of 10× PCR buffer, 1.25 µl of MgCl2 (50 mM), 0.25 µl of each primer (0.01 mM), 0.125 µl of each dNTP (0.05 mM), 1 µl (0.625 U) of Taq polymerase, and 0.5–2.0 µl of DNA template. Amplifications were performed using ABI thermal cycler (Thermo Fisher Scientific). The thermal regime consists of an initial step of 2 min at 95°C followed by 35 cycles of 0.5 min at 94°C, 0.5 min at 54°C, and 1 min at 72°C, followed in turn by 10 min at 72°C and then held at 4°C. PCR products were visualized on 1% agarose gel. The PCR products were purified using PureLink™ PCR purification kit and sequenced from First BASE Laboratories, Sdn Bhd, Malaysia. All sequences were translated into amino acids to confirm the effectiveness of the sequences and to detect the presence of nuclear DNA pseudo genes, insertions, deletions, or stop codons. Sequences were checked and aligned using Sequencer v5.4.6 and were submitted to GenBank with referred accession numbers. All the data including taxonomic characteristics and GenBank accession numbers were tagged with the voucher specimens preserved at the Professor Kazi Zaker Husain Museum of Department of Zoology, University of Dhaka. Bioinformatic and statistical analyses: Bioinformatic analyses of the sequences were performed using CLC Workbench v7.7.1, Mega X, Clustal Omega, and T-Coffee. Base compositions were analyzed using CLC Workbench v7.7.1 and Mega X. Genetic distance and sequence divergences were calculated using the Kimura two parameter (K2P) distance model (Kimura 1980). Neighbor-joining (NJ) trees of K2P distances were created to provide a graphic representation of divergence pattern between species (Saitou and Nei 1987). Bootstrapping was performed in MEGA X (Tamura and Nei 1993) with 1000 replications (Felsenstein 1985). Necessary statistical analyses were performed in Excel 2013 and RStudio.

  Bangladesh J. Zool. 48(1): 1-19, 2020
  DOI: https://doi.org/10.3329/bjz.v48i1.47872
Funding Source:
1.   Budget:  
  

The present study revealed that DNA barcoding has been successful in identifying the freshwater fishes of Bangladesh. We have barcoded 153 species of freshwater fishes and these barcode data confirms the 12 new records from Bangladesh. When traditional morpho taxonomy does not work, this molecular tool is effective for species identification, particularly with specimens that are damaged, incomplete, or morphologically distinct stages. Nevertheless, DNA barcoding also has its limitations too. Therefore, DNA barcoding can serve as a complementary tool for species identification, but it cannot replace the traditional morpho-taxonomy. Through this study, a reliable DNA barcode reference library for Bangladeshi freshwater fish was established, which could be used to assign fish species by screening sequences against it in the future. This could enhance to achieve better monitoring, conservation, and management of fisheries in this overexploited country.

  Journal
  


Copyright © 2026. Bangladesh Agricultural Research Council.