Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
M. S. Akhter
Plant Pathology Division, BARI, Gazipur

A survey was conducted for identification of watermelon diseases in Nothern part of Bangladesh in the 2018-19 cropping season. Two viral diseases and two fungal diseases have been identified using molecular tools. Among the viral diseases watermelon bud necrosis virus (WBNV), Groundnut bud necrosis virus which is a member of Orthotospovirs and are the major threats to watermelon production in Bangladesh. On the other hand, the mosaic disease having a low frequency compared to Tospovirus. Two fungal diseases namely leaf spot caused by Alternaria sp and wilt caused by Fusarium sp have been identified based on pathogenicity and morphological characterization. 

  Water melon disease, Molecular Tools, Survey and identification
  A survey was conducted for the identification of watermelon diseases in Nothern part of Bangladesh
  00-00-2018
  00-00-2019
  Pest Management
  Diseases, Water melon

To identify disease causal organisms using recent advanced available molecular tools so that farmers will be availed to use appropriate control measures for the particular diseases.  

Survey has been conducted at farmers’ fields of two different watermelon growing areas (Godagari; Rajshahi & Gorudaspur, Nator) and HRC, experimental field BARI, headquarter in 2018-19 cropping season. The disease incidence of different types of diseases has been recorded and symptomatic samples were brought to the PPD, BARI, for further studies.

  1. Identification of viral diseases of watermelon.
  1. Direct antigen-coated enzyme-linked immunosorbent assay (DAC-EISA)

Direct antigen-coated enzyme-linked immunosorbent assay (DAC-ELISA) (Clark and Bar-Joseph, 1984) was performed to detect the association of an orthotospovirus with the BND diseased in watermelon samples. The assay was performed in 96 well polystyrene microtitre plates (Costar, Sigma, USA). Briefly, 96 well plates were coated with diseased leaf extracts diluted 1:4 (w/v) in coating buffer contained 15mM sodium carbonate, 35mM sodium bicarbonate, 2% polyvinylpyrrolidone (PVP- 40) with pH 9.6 and incubated at 37 °C for 1 h. After three subsequent washing with PBS-T buffer contained 136mM NaCl, 1.4mM KH2PO4, 2.6mM KCl, 8mM Na2HPO4, 0.05% Tween-20, with adjusted pH 7.4, these plates were further blocked with 2% bovine serum albumin (BSA) for 1 h at 37 °C. After three repeated washing with PBS-T, specific antiserum against the nucleocapsid (N) protein of groundnut bud necrosis orthotospovirus (GBNV) generated at ACPV, IARI, New Delhi was diluted (1:1000) with PBS-TPO contained PBS-T with 2% PVP-40 and 0.2% ovalbumin was loaded to the wells of ELISA plate and incubated at 37 °C for 1 h followed by three washing with PBS-T. Goat anti-rabbit IgG-AP conjugate (Sigma-Aldrich, St. Louis, USA at a dilution of 1:30,000 in PBS-TPO) was added and incubated at 37 °C for 1 h. Finally, the plates were washed thrice with PBS-T and para-nitrophenyl phosphate (pNPP) substrate (at 0.5 mg/ml pNPP dissolved in 9.7% diethanolamine buffer, pH 9.6) was added. The OD values @ 405 nm were measured by ELISA reader (TECAN A-5082, Sun Rise, Austria) after 1 h of substrate incubation at 37 °C. Watermelon samples showing absorbance (O.D. at 405) values more than two times than that of healthy control were considered as infected with the orthotospovirus.

  1. Reverse-transcription polymerase chain reaction (RT-PCR

The ELISA positive watermelon samples were further subjected for the specific detection of WBNV virus isolate by duplex reverse transcription-polymerase chain reaction (RT-PCR) using species-specific forward primers (for GBNV: Gs1F: 5′-ATGGTTGAAAAGAGCAAGAATG. ATGC-3′ and for WBNV: Ws1F: 5′-CAAAGACTTGTTGGCTGGTGG TG- 3′) and a common degenerate reverse primer (for both GBNV and WBNV GWs1R: 5′-CTTCTT (A/T) GA (A/G) TGT (AC/T) CACCATA (A/ G) TCATCC-3′) designed using N gene sequences of both the viruses and were used as described by Akhter et al. (2012). Total RNA was extracted from the infected and healthy (control) watermelon samples (∼100 mg) using RNeasy plant mini kit (Promepa, USA) according to the manufacturer's instruction. Extracted RNA was used as a template for RT-PCR along with the positive control. The first-strand cDNA was synthesized using ImProm-II™ reverse transcriptase kit (Promega, USA). The 20 μl cDNA reaction mixture contained 8 μl template RNA (∼2.5 μg), 1 μl (100 pg) reverse primer, 2 μl 25mM MgCl2, 1 μl 10mM dNTP, 4 μl 5× buffer, 0.5 μl RNase inhibitor (40 Uμl−1) (Promega, USA) and 2.5 μl sterile distilled water and 1 μl reverse transcriptase (200 Uμl−1) was incubated at 42 °C for 60 min. The 25 μl PCR reaction mixture comprised 5 μl template cDNA, 5 μl 5 X PCR buffer, 3.5 μl 25mM MgCl2, 2.5 μl 10mM dNTP, 3.0 μl (∼100 pg) each of reverse and two forward primers, 1.0 μl of Taq DNA polymerase and sterile distilled water up to 25 μl. The PCR was conducted in a thermal cycler (Biometra, Germany) with the following temperature conditions: 2 min hot start at 94 °C followed by 30 cycles of denaturation at 94 °C for 30 s, annealing for 1 min at 52 °C and synthesis at 72 °C for 1 min, and a cycle of final extension at 72 °C for 10 min. The PCR product was analysed in 1% agarose gel in Tris-acetate EDTA containing ethidium bromide (Sambrook and Russell, 2001).

  1. Identification of fungal diseases
  1. Isolation and Morphological characterization of the associated fungi

Infected plant parts of watermelon were collected and brought to the Plant Pathology Laboratory of Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh for identification and characterization of the fungi. Pieces of the diseased tissues of watermelon were sterilized by 10% chlorox for 2-3 minutes, followed by several rinses with sterile distilled water and placed on potato dextrose agar (PDA). After a day single spore was collected using a sterilized glass needle under a dissecting microscope and transferred to Petri plates containing PDA media and incubate at 25±5oC for up to 12 days. After incubation, the appearance of the colonies, and the vegetative and reproductive structures of fungus were examined under stereo as well as a compound microscope.

  1. Pathogenecity test of the isolated fungi

Pathogenicity test was conducted on symptomless detached leaf of watermelon with slight modification (Akhter et al. 2009). The mycelial plug (6mm) of one isolate (AL2) was placed on the watermelon leaf which was previously wounded by sterile needle and kept the inoculated leaf on the porcelain plate of the dedicator. Total 3 leaf was inoculated by the AL2 isolate and 1 leaf were mock inoculated by the PDA plug (6mm) without fungi. After inoculation, the dedicators were incubated at 25°C with 90% relative humidity in 12h light/12h dark conditions.

  1. Molecular identification of the associated fungi using sequencing

Total genomic DNA of pathogenic fungi was extracted from 12 days old mycelium using a commercial DNA extraction kit (Promega, USA) according to protocol supplied by the manufacturer and PCR was done using Thermocycler (Nyx Technik, USA). The universal primers for PCR were obtained from Invent Technology, Bangladesh. The primer pairs ITS1, 5’CGGATCTCTTGGTTCTGGCA3’ and ITS4, 5’GACGCTCGAACAGGCATGCC3’were used for rDNA amplification (White  1990). The PCR amplification was carried out in 25µl reaction mixture containing 1ng of DNA added to 5µl of 5× PCR buffer, 2.0µl of 25mM MgCl2, 2.0µl of 2mM dNTPs (Promega, USA), 20pmol of each forward and reverse primer (1.0µl) and 0.2µl of Taq DNA Polymerase and made up to 25µl with nuclease free water. The PCR conditions include initial denaturation at 94ºC for 3min, 30 cycles of denaturation at 94ºC for 30s, annealing at 48ºC for 30s, followed by extension for 30s at 72ºC and a final extension at 72ºC for 10min. After amplification, the size and concentration of PCR products were verified by 1.5 % agarose gel in Tris-borate-EDTA (TBE) buffer

  Annual Research Report 2018-19, Plant Pathology Division, BARI, Gazipur
  
Funding Source:
1.   Budget:  
  

On the basis of the present study, we have identified two fungal and two viral diseases of watermelon using advanced molecular tools. The identification of the other diseases of watermelon in Bangladesh and the interaction of host-microbe interaction on different watermelon genotypes are in progress.  

  Report/Proceedings
  


Copyright © 2026. Bangladesh Agricultural Research Council.