Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
F. Alam
Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh.

M. E. Ali
Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh

M. F. A. Anik
Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh

M. Rahman
Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh

M. A. H. Bhuiyan
Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh.

M. A. Hossain
Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh

A pot experiment was conducted at net house, Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur to evaluate the effect of Rhizobium strains on performance of soybean during the rabi season in 2016-2017 and their symbiotic and molecular characterization in 2017-2018. The crop variety was BARI soybean-6 and five Rhizobium strains were used. There were six treatments viz. T1: BARI RGm 901, T2: BARI RGm 902, T3: BARI RGm 903, T4: BARI RGm 904, T5: BARI RGm 905, T6: Control which were replicated four times. Peat based rhizobial inoculum was used at the rate of 1.5 kg ha-1 as seed inoculant. Rhizobium strain BARI RGm 905 inoculated soybean increased nodule number (13.9 number plant-1), nodule weight (0. 069g plant-1). The highest root weight (0.34 g plant-1) and shoot weight (4.07 g plant-1) and plant height (56.3 cm) were recorded in Rhizobium strain BARI RGm 901. It was observed that Rhizobium strain BARI RGm 905 inoculated plant produced the highest seed yield (7.24 g plant-1, 34.6% higher over uninoculated control of plant which was identical with all other treatments except uninoculated control plant. This indicates that Rhizobium strains established effective symbiotic relationship with soybean that exhibited better performance in soybean. DNA was isolated from Rhizobium strains, amplified by PCR, and purified DNA were sequenced to know their phylogeny. All Rhizobium strains sequence result showed that these strains were belongs to Rhizobiales order, Rhizobiaceae family and genus Rhizobium.

 

  Rhizobial strains, N2 fixation, Soybean, Gypsum, Zinc sulphate, Boric acid
  The net house, Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh
  00-00-2017
  00-00-2018
  Crop-Soil-Water Management
  Fertilizer, Bio fertilizer, Soybean

To isolate and identify rhizobial strains from stress areas of Bangladesh, their symbiotic and molecular characterization and N2 fixation capacity in soybean. 

A pot experiment was carried out at net house, Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur (24.00o N latitude, 90.25o E longitude and 8.4 m elevation) on 05 January 2017 during rabi season. The pot soil belongs to the Chhiata series of Grey Terrace Soil. The experiment was laid out in Complete Randomized Design (RCD) with four replications. There were six treatments viz. T1: BARI RGm 901, T2: BARI RGm 902, T3: BARI RGm 903, T4: BARI RGm 904, T5: BARI RGm 905, T6: Control which were replicated into four. The tested crop was soybean (cv. BARI Soybean-6). Peat based rhizobial inoculum containing 108 cells  g-1 inoculum was used at the rate of 1.5 kg ha-1. Soybean seeds were mixed thoroughly with the inoculum before sowing. Seeds were used at the rate of 75 kg ha-1. Phosphorus, potassium, sulphur, zinc and boron (P42K40S40Zn5B1 kg ha-1) were used in the form of TSP, MoP, gypsum, zinc sulphate and boric acid, respectively. All P, K, S, Zn, B were applied at the time of pot preparation. All the intercultural operations such as irrigation, weeding, insect control etc. were done as and when necessary. Nodules were collected by carefully uprooting five sample plants selected randomly from each unit plot at the 50 percent flowering stage. Nodules were separated from the roots, counted and then oven-dried and weighed. Data on yield and yield components were recorded at maturity. The crop was harvested on 02 May 2017. The initial soil samples at a depth of 0-15 cm from the experimental fields were collected and analyzed following standard methods.

Bacteria isolation and PCR amplifications of 16S rDNA:

Rhizobium strains were isolated from soybean plants nodules. Nodules were collected aseptically and crushed in 100 μl of sterile distilled water using a homogenizer. A loop full of suspension was streaked onto yeast extract mannitol (YEM) agar plates and incubated at 30 °C for 2 to 3 days. A single colony was isolated and purified by repeated streaking on YEM agar plates. These colonies were preserved on agar slants at 4 °C until further use. Isolated bacteria were cultured in test tubes (Pyrex®, USA) containing 3 ml in YEM liquid broth by shaking in a rotary shaker (KSI-100L Shaking Incubator, Koencon, Hanam, Korea) at 180 rpm, 30°C, for 48 hours, and the cultures were centrifuged at 18,000 g for 5 minutes at 4°C. Genomic DNA was extracted from the pellet using the FastDNA SPIN Kit (MP Biomedicals, Santa Ana, CA, USA), and DNA yield was quantified using a spectrophotometer (NanoDrop 2000C, Thermo Scientific, Waltham, MA, USA). The extracted bacterial DNA was used as a template for PCR amplification of 16S rDNA. Bacterial 16S rDNA was amplified by PCR with the forward primer 27F (5´- AGAGTTTGATCCTGGCTCAG -3´) and reverse primer 1492R (5´- GGTTACCTTGTTACGACTT -3´). About 50 ng of template DNA was used in each reaction. The PCR conditions and primer sequences used for sequencing. PCR products were gel purified using the QIAEX®II Gel Extraction Kit (Qiagen GmbH, Hilden, Germany). 

Sequencing and phylogenetic analysis:

DNA sequencing was performed using an Applied Biosystems 3730 automated sequencer with the M13 primer to obtain nearly full-length bacterial 16S rDNA sequences. The bidirectional gene sequences were compiled using DNAMAN software (DNAMAN version 4.11, Lynnon Biosoft, San, Ramon, CA, USA), and the sequences were analyzed using MEGA 5.2 software. The consensus sequence was used in a BLAST search of the NCBI GenBank database. Phylogenetic analysis was conducted using MEGA version 5.2, and a neighbor-joining tree was constructed using Kimura 2-parameter distances with 1000 replicates to estimate bootstrap support. The compiled sequence of the Rhizobium sp. strains will be deposited in the GenBank database and assigned accession number. 

Methods of chemical analysis:

Soil pH was measured by a combined glass calomel electrode (Jackson, 1958). Organic carbon was determined by wet oxidation method (Walkley and Black). Total N was determined by modified Kjeldahl method. Calcium, K and Mg were determined by NH4OAc extraction method. Copper, Fe, Mn and Zn were determined by DTPA extraction followed by AAS reading. Boron was determined by CaCl2 extraction method. Phosphorus was determined by Bray and Kurtz method (Acid soils) and Modified Olsen method (Neutral + Calcareous soils). Sulphur was determined by CaH4(PO4)2.H2O extraction followed by turbidimetric turbidity method with BaCl2.

  Annual Research Report 2017-2018, Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur, Bangladesh
  
Funding Source:
1.   Budget:  
  

Application of Rhizobium strains inoculated plants exhibited better performance in nodule numbers, nodule weights, aboveground biomass, root biomass, and plant height than non-inoculated plants, indicating that all Rhizobium sp. effectively enhanced nodulation and growth parameters on soybean plant than non-inculated soybean. Soybean plants inoculated with Rhizobium sp. BARI RGm 905 showed higher pod yield, stover yield, and seed yield than non-inoculated plants, revealing the positive impact of Rhizobium sp. BARI RGm 905 on yield parameters of soybean. Therefore, Rhizobium sp. BARI RGm 905 established an effective symbiotic association with soybean and was responsible for increased growth and biomass, and improved yield characteristics of soybean of gray terrace soils. DNA was isolated from Rhizobium strains, amplified by PCR, and purified DNA were sequenced. All strains sequence result showed that these strains were belongs to Rhizobiales order, Rhizobiaceae family and genus Rhizobium.

  Report/Proceedings
  


Copyright © 2026. Bangladesh Agricultural Research Council.