Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Validation of Clonal Line Females for Sex Determination Studies in Nile Tilapia Oreochromis Niloticus L.

Mohd Golam Quader Khan
Department of Fisheries Biology and Genetics, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh

Brendan J McAndrew
Institute of Aquaculture, University of Stirling, Stirling FK9 4LA, Scotland, UK,

David J Penman
Institute of Aquaculture, University of Stirling, Stirling FK9 4LA, Scotland, UK,

Abstract/ Executive Summary:

Sex determination in the Nile tilapia Oreochromis niloticus is more complex than a simple XX-XY sex determining mechanism, as evidenced from fairly frequent unexpected sex ratios in progeny. The production of uniform, homozygous experimental material is particularly advantageous for studying sex determining mechanism as well as for the genetic mapping and genome sequencing studies in which interpretations are facilitated by homozygosity. To better understand the genetic mechanism of sex determination, a fully inbred line of clonal females (XX) was verified in controlled environmental conditions using test crosses and microsatellite DNA markers from the tilapia linkage map. A total of successfully amplified 87 microsatellite DNA markers covering all 24 linkage groups were selected for screening sexually mature females from this line. 67 markers were found polymorphic in outbred individuals screened. Markers from LG1, LG3 and LG23 were given more emphasis because sex determining genes have been mapped on these LGs in different species of tilapia. The verification and validation of this clonal line of females made them an important resource to use as a ‘standard reference line’ in genomics, sex determination studies and other studies in Nile tilapia.

Keywords: Clonal line, Microsatellite marker, Sex, Nile tilapia, Oreochromis niloticus.

Location: BAU, Mymensingh

Start Date:

End Date:

Program Area: Animal Health and Management

Commodity: Tilapia

Objectives:

The present study was performed to verify fully inbred females of a clonal line (previously developed by gynogenesis) using microsatellite DNA markers from across the tilapia genome, and to validate the line as a reference line for studies on sex determination of Nile tilapia.

Methodology:

Fish Stock: A number of fully inbred clonal lines of O. niloticus were produced previously by gynogenesis (Sarder et al., 1999; Ezaz et al., 2004b). Many of these showed low fertility. One XX line that showed good fertility was maintained in the Tropical Aquarium Facilities, Institute of Aquaculture, University of Stirling and the line advanced through breeding of clonal females and clonal neomales (the latter produced by hormonal masculinisation). Six sexually mature females from this inbred line were selected for the study. Each of the females was tagged with a passive integrated transponder (PIT) tag and kept in a glass tank. Six outbred females were also reared to be used for comparison of sex ratios with clonal females for a range of males. The basic maintenance of the experimental stock rigorously followed working procedures under ASPA (Animals Scientific Procedures Act, 1986) and monitored by the Home Office in the United Kingdom. DNA extraction and quantification: DNA was extracted from fin clips using the REAL kit method (REAL laboratory, Spain) and quantified with a Nanodrop spectrophotometer (Thermo Fisher Scientific, USA). Selection of DNA markers DNA markers were selected from the tilapia linkage map (Lee et al., 2005). Markers were chosen to be approximately evenly spaced from each linkage group to cover the whole genome. A total of 93 microsatellite DNA markers covering all 24 LGs were selected for this study (Table 1). The number of markers per LG ranges from one to six depending on the size of LG. Markers from LG1, LG3 and LG23 were given more emphasis in selection criteria (n=26) because sex determining genes have been mapped on these LGs in different species of tilapia (Lee et al., 2003, 2004; Shirak et al., 2006). DNA amplification: Polymerase chain reaction of the quantified DNA from clonal females was carried out in 15 μl reaction mixtures, using three different “tailed” fluorescent primers to label the PCR products. The components used for a single reaction mixture are 1X Reaction buffer, 1.5 mM MgCl2, 0.2 mM of dNTPs, 0.3 μM Labeled primer, 0.3 μM FW/RV primer, 0.02μM Tailed primer, 0.05U/μl and 0.05μg to 1 μg template DNA. The thermocycler conditions varied for the different fluorescent primers: M13 blue (ggataacaatttcacacagg), CAG tag green (cagtcgggcgtcatca) and Godde black (catcgctgattcgcacat). The forward and reverse sequences of the primers were retrieved from the NCBI databank and any one of the three fluorescent sequences (blue or green or black) was added at 5’ end of either the forward or of the reverse primer, thus that primer was the ‘tailed’ primer. The annealing temperatures for markers from LG1, LG3 and LG23 were determined from saltadjusted and base stacking melting temperatures (Mueller et al., 1994; Santalucia, 1998) and used in PCR (Table 3) with some modifications. PCR was performed at 95ºC for 14 min followed by 40 cycles of 95ºC for 1 min, one or two-step annealing temperatures (Table 3) for markers from LG1, 3 and 23, 72ºC for 1 min, with a final elongation step of 72 ºC for 30 min. For the rest of the markers, annealing temperatures of 57oC, 58oC and 60oC were used for tailed primers having M13 blue, CAG tag green and Godde black, respectively. Evaluation of sex ratios between clonal females and sex-reversed neomales Once the clonal nature of the females was determined, sex ratios were observed in crosses between females and neomales (hormonally masculinized XX individuals) within this line. A total of 8 crosses were performed, four neomales each crossed to two females, with six different females involved. The survival rates in clonal line progeny were also compared with those in outbred groups on day 11, after the completion of yolk sac absorption period.

Source of Information: Res. Agric., Livest. Fish. Vol. 1, No. 1, December 2014: 147-158

Article Link (Online Journal):

Funding Source:

Total Budget (Tk.) :

Achievement/Findings:

The homozygous nature of the clonal line females in this study with good number of microsatellite markers, the yield of very close to 100% female progeny with sex-reversed neomales suggests that this line of clonal females could be used as standard, ‘reference line’ for genomics, sex determination and other studies in Nile tilapia.

Knowledge Management: Journal