Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Precise Incubation Period for the Agrobacterium Mediated Transformation Efficiency in Potato (solanum Tuberosum L.) Cvs. Cardinal and Atlas

S. R. Sarker
Plant Breeding and Gene Engineering Laboratory, Department of Botany, Rajshahi University, Rajshahi

M. Hossain
Plant Breeding and Gene Engineering Laboratory, Department of Botany, Rajshahi University, Rajshahi

F. Shirin
Plant Breeding and Gene Engineering Laboratory, Department of Botany, Rajshahi University, Rajshahi

Abstract/ Executive Summary:

Precise incubation period facilitates significant response to Agrobacterium‐ mediated genetic transformation of potato (Solanum tuberosum L.) cvs. Atlas and Cardinal. The protocol yielded an average transformation rate of 58.4% for internodal explants compared to 38% for leaf explants in Atlas while 47.6% for intenodal explants as against 7.6% for leaf explants in Cardinal. Highest survival rate and transient GUS activity were shown by Atlas and Cardinal at 45 min of incubation with Agrobacterium. The plants were analyzed histochemically for GUS activity in their leaves and internodes. All these analysis indicated that each independently selected and regenerated plants of Atlas and Cardinal were GUS positive and transient

Keywords: Transformation, Incubation period, Potato cultivars

Location:

Start Date:

End Date:

Program Area: Variety and Species

Commodity: Potato

Objectives:

In this study the main consideration was the implementation of gene technology for establishing pathogen resistance in local agronomical field where the potato cultivars Atlas and Cardinal had a huge impact on market value.

Methodology:

Leaf and internodal explants of potato (Solanum tuberosum L.) cvs. Atlas and Cardinal excised from three ‐ four weeks old shoot cultures were used for the experiments. Agrobacterium strain and plasmid: Agrobacterium tumefaciens strain LBA4404 (pVDH65, pTOK47) designated 1065 was used (Curtis et al. 1994). LBA4404 (1065) contained the binary vector pVDH65 and a supervirulent plasmidpTOK47 (Jin et al. 1987). The binary vector pVDH65, based on the pBIN19 derivative pMOG18 carried a T‐DNA with the chimeric nos.nptII.nos and intron‐gus genes and was received from CAMBIACultures were grown at 20ºC in a 16 hr light (60 μE m2s; cool white fluorescent tubes) period. All plant media were adjusted with 1N NaOH to pH 5.7, solidified with 8 g/l agar and autoclaved at 121⁰C for 20 min. The sensitivity of potato leaf and internodes to kanamycin was assayed by culturing them with A. tumefaciens without co‐cultivation on the selection medium containing different concentrations of kanamycin (0, 25, 50, 75 and 100 mg/l).The presence of transgenes in transformed and control plants was analyzed by the polymerase chain reaction (PCR). Genomic DNA of potato was extracted from young leaves following the protocol of Edwards et al. 1991. PCR analyses to detect the presence of nptІІ gene were carried using the PCR Screening Kit (Sigma Chemical Ltd., USA) in the presence of following pair of primers: forward primer (5‐GTTGCTCTCAAGGGACTTGC‐3) and reverse primer (5‐CACACACCGTGACCCTTTC‐3). The PCR mixtures were denatured at 94ºC for 4 min followed by 35 cycles for 1 min at 94ºC, 1 min at 58ºC for annealing, 1.30 min at 72ºC for extension and finally incubated at 72ºC for 10 min. Expected PCRproduct size was about 365 bps. Amplified cDNA were resolved on 1.5 ‐ 2% agarose gel, stained with ethidium bromide (EtBr) and documented.

Source of Information: Plant Tissue Cult. & Biotech. 19(2): 227-235, 2009 (December)

Article Link (Online Journal):

Funding Source:

Total Budget (Tk.) :

Achievement/Findings:

Atlas and Cardinal are the most important potato varieties in Bangladesh especially for its production and taste quality. However, they are mostly affected by the viral, bacterial and fungal diseases with the reduction of productivity. Therefore, Agrobacterium‐mediated genetic transformation is one of the best solutions for recovering precise tuber growth of potatoes with low financial support in a developing country like Bangladesh. The present study describes ashort duration, reproducible and efficient protocol for production of transgenic plants of potato cultivars Atlas and Cardinal with the nptII gene as a selectable marker gene and GUS gene as a reporter gene. In the present investigation the highest transformation frequency of potato cvs. Atlas and Cardinal has been found at 45 min incubation with A. tumefaciens.

Knowledge Management: Journal