Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Prevalence, Characterization and Antibiotic Susceptibility of Vibrio Parahaemolyticus Isolated from Fishes and Shellfishes of Coastal Regions of Bangladesh

MD. MANIRUL HAQUE
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

ANWAR HOSSAIN
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

SHANKAR CHANDRA MANDAL
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

MOHAMMAD SHAMSUR RAHMAN
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

ZAHID HAYAT MAHMUD
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

Abstract/ Executive Summary:

Occurrence of Vibrio parahaemolyticus in fishes and shellfishes of coastal regions of Bangladesh was investigated. Fish and shellfish samples were collected from three coastal areas, namely Kuakata, Chittagong and Cox’s Bazar. Thirty five V. parahaemolyticus strains were isolated from 33 finfish and 6 shellfish samples where all the isolates were tlh positive which was species specific gene and no isolate had possessed the virulence gene encoding tdh. Overall prevalence rate of V. parahaemolyticus in fish sample was 45.45%; having 18.75% from Kuakata, 22.22% from Chittagong and 62.5% from Cox’s Bazar. Fifty per cent shellfish were found to be positive for V. parahaemolyticus. Antibiotic susceptibility of the isolated strains was carried out against 11 antibiotics where the isolates were sensitive to the tested antibiotics except metronidazole (50 μg) and nalidixic acid (30 μg). Presence of this pathogenic organism in fish and shellfish could pose a serious threat to fish industry as well as human health hazard in Bangladesh.

Keywords: Prevalence, Characterization, Antibiotic susceptibility, Vibrio parahaemolyticus

Location: Chittagong and Cox’s Bazar

Start Date: 00-03-2013

End Date: 00-06-2013

Program Area: Resource Development and Management

Commodity: Aquatic animal

Objectives:

To investigate the prevalence and characterization of V. parahaemolyticus in fish and shellfish of coastal regions of Bangladesh.

Methodology:

A total of 33 different finfish and 6 shellfish with three replicates were collected from Kuakata sea beach, Chittagong and Cox’s Bazar BFDC Fisheries market which are the most economically important species from coastal regions of Bangladesh. Samples were collected during March to June, 2013. After collection, the samples were stored in the refrigerator at –20ºC and were processed within 24 hours. The muscle, gill and intestine were separated aseptically following the method of American Public Health Association (APHA. In case of shellfish only muscle sample was taken for microbial analysis. Then samples were homogenized with phosphate buffer solution (PBS) using homogenizer. One hundred μl of homogenized samples were spreaded on TCBS and CV plate and incubated for 18 ? 24 hours at 37ºC. Green colonies from TCBS plate and violet colonies from CV plates were suspected for V. parahaemolyticus. Suspected characteristic colonies subcultured on gelatin agar (GA) plates. After incubation, the colonies showing gelatinase activity were subcultured on TCBS and CV plate following patch inoculation technique for further confirmation. The presence of cytochrome oxidase was detected by Kovacs’ oxidase test(9). Colonies green on TCBS, violet on CV plate, gelatinase positive and cytochrome oxidase positive were then subjected to biochemical test(2). Salt tolerance (0, 6.5 and 8% salt [w/v] with 1% peptone supplement) of isolates were also observed. DNA was extracted from biochemically identified positive strains using heat treatment. Multiplex PCR amplification was performed. PCR primer for tlh was F?tlh: 5??AAAGCGGATTATGCAGAAGCACTG?3?, R?tlh: 5??GCTA CTTTCTAGC ATTTTCTCTGC ?3? and PCR primer for tdh was F?tdh: 5??GTAA AGGTCTCTGACTTT TGGAC?3?, R?tdh: 5??TGGAATAGAACCTTCATCTTCACC?3?. PCR amplification of the target DNA was carried out in a thermal cycler (BIO RAD, PTC? 0200G, USA). The amplification of the target genes through PCR was determined by gel electrophoresis in 1% agarose. During gel electeophoresis a 100 bp molecular weight marker was used as standards to compare the amplicon size of the PCR products. After migration for 2 hours at 90 volts, the gel was stained with ethidium bromide and photographed in an UV?transilluminator (Alpha Innotech, SA?1000, USA). Antibiotic susceptibility was carried out using the disc diffusion method. Procedures were based on the standardization of disc agar diffusion method of the National Committee for Clinical Laboratory Standards for antimicrobial susceptibility tests. Isolates were inoculated on Mular Hinton Broth (Hi?Media, M173?500G, India) and incubated for 6 hours. The bacterial suspension was then inoculated onto the surface of the Muller?Hinton agar using sterile cotton swabs, which were then left to dry for 10 minutes. The antimicrobial sensitivity discs (Hi?Media, India) were applied on the agar surface. The discs used in the study were Ampicillin (10 μg), chloramphenicol (30 μg), erythromycin (15 μg), gentamicin (10 μg), nitrofurantoin (300 μg), oxolinic acid (20 μg), tetracycline (30 μg), metronidazole (50 μg), nalidixic acid (30) and ciprofloxacin (5 μg). The plates were incubated for 18 ? 24 hrs at 37ºC and then the zone of inhibition was measured.

Source of Information: Dhaka Univ. J. Biol. Sci. 24(2): 121-129, 2015 (July)

Article Link (Online Journal):

Funding Source:

Total Budget (Tk.) :

Achievement/Findings:

Fifty per cent shellfish were found to be positive for V. parahaemolyticus. Antibiotic susceptibility of the isolated strains was carried out against 11 antibiotics where the isolates were sensitive to the tested antibiotics except metronidazole (50 μg) and nalidixic acid (30 μg). Presence of this pathogenic organism in fish and shellfish could pose a serious threat to fish industry as well as human health hazard in Bangladesh.

Knowledge Management: Journal