Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
MD. MANIRUL HAQUE
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

ANWAR HOSSAIN
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

SHANKAR CHANDRA MANDAL
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

MOHAMMAD SHAMSUR RAHMAN
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

ZAHID HAYAT MAHMUD
Department of Fisheries, University of Dhaka, Dhaka‐1000, Bangladesh

Occurrence of Vibrio parahaemolyticus in fishes and shellfishes of coastal regions of Bangladesh was investigated. Fish and shellfish samples were collected from three coastal areas, namely Kuakata, Chittagong and Cox’s Bazar. Thirty five V. parahaemolyticus strains were isolated from 33 finfish and 6 shellfish samples where all the isolates were tlh positive which was species specific gene and no isolate had possessed the virulence gene encoding tdh. Overall prevalence rate of V. parahaemolyticus in fish sample was 45.45%; having 18.75% from Kuakata, 22.22% from Chittagong and 62.5% from Cox’s Bazar. Fifty per cent shellfish were found to be positive for V. parahaemolyticus. Antibiotic susceptibility of the isolated strains was carried out against 11 antibiotics where the isolates were sensitive to the tested antibiotics except metronidazole (50 μg) and nalidixic acid (30 μg). Presence of this pathogenic organism in fish and shellfish could pose a serious threat to fish industry as well as human health hazard in Bangladesh.
  Prevalence, Characterization, Antibiotic susceptibility, Vibrio parahaemolyticus
  Chittagong and Cox’s Bazar
  00-03-2013
  00-06-2013
  Resource Development and Management
  Aquatic animal

To investigate the prevalence and characterization of V. parahaemolyticus in fish and shellfish of coastal regions of Bangladesh.

A total of 33 different finfish and 6 shellfish with three replicates were collected from Kuakata sea beach, Chittagong and Cox’s Bazar BFDC Fisheries market which are the most economically important species from coastal regions of Bangladesh. Samples were collected during March to June, 2013. After collection, the samples were stored in the refrigerator at –20ºC and were processed within 24 hours. The muscle, gill and intestine were separated aseptically following the method of American Public Health Association (APHA. In case of shellfish only muscle sample was taken for microbial analysis. Then samples were homogenized with phosphate buffer solution (PBS) using homogenizer. One hundred μl of homogenized samples were spreaded on TCBS and CV plate and incubated for 18 ? 24 hours at 37ºC. Green colonies from TCBS plate and violet colonies from CV plates were suspected for V. parahaemolyticus. Suspected characteristic colonies subcultured on gelatin agar (GA) plates. After incubation, the colonies showing gelatinase activity were subcultured on TCBS and CV plate following patch inoculation technique for further confirmation. The presence of cytochrome oxidase was detected by Kovacs’ oxidase test(9). Colonies green on TCBS, violet on CV plate, gelatinase positive and cytochrome oxidase positive were then subjected to biochemical test(2). Salt tolerance (0, 6.5 and 8% salt [w/v] with 1% peptone supplement) of isolates were also observed. DNA was extracted from biochemically identified positive strains using heat treatment. Multiplex PCR amplification was performed. PCR primer for tlh was F?tlh: 5??AAAGCGGATTATGCAGAAGCACTG?3?, R?tlh: 5??GCTA CTTTCTAGC ATTTTCTCTGC ?3? and PCR primer for tdh was F?tdh: 5??GTAA AGGTCTCTGACTTT TGGAC?3?, R?tdh: 5??TGGAATAGAACCTTCATCTTCACC?3?. PCR amplification of the target DNA was carried out in a thermal cycler (BIO RAD, PTC? 0200G, USA). The amplification of the target genes through PCR was determined by gel electrophoresis in 1% agarose. During gel electeophoresis a 100 bp molecular weight marker was used as standards to compare the amplicon size of the PCR products. After migration for 2 hours at 90 volts, the gel was stained with ethidium bromide and photographed in an UV?transilluminator (Alpha Innotech, SA?1000, USA). Antibiotic susceptibility was carried out using the disc diffusion method. Procedures were based on the standardization of disc agar diffusion method of the National Committee for Clinical Laboratory Standards for antimicrobial susceptibility tests. Isolates were inoculated on Mular Hinton Broth (Hi?Media, M173?500G, India) and incubated for 6 hours. The bacterial suspension was then inoculated onto the surface of the Muller?Hinton agar using sterile cotton swabs, which were then left to dry for 10 minutes. The antimicrobial sensitivity discs (Hi?Media, India) were applied on the agar surface. The discs used in the study were Ampicillin (10 μg), chloramphenicol (30 μg), erythromycin (15 μg), gentamicin (10 μg), nitrofurantoin (300 μg), oxolinic acid (20 μg), tetracycline (30 μg), metronidazole (50 μg), nalidixic acid (30) and ciprofloxacin (5 μg). The plates were incubated for 18 ? 24 hrs at 37ºC and then the zone of inhibition was measured.
  Dhaka Univ. J. Biol. Sci. 24(2): 121-129, 2015 (July)
  
Funding Source:
  

Fifty per cent shellfish were found to be positive for V. parahaemolyticus. Antibiotic susceptibility of the isolated strains was carried out against 11 antibiotics where the isolates were sensitive to the tested antibiotics except metronidazole (50 μg) and nalidixic acid (30 μg). Presence of this pathogenic organism in fish and shellfish could pose a serious threat to fish industry as well as human health hazard in Bangladesh.

  Journal
  


Copyright © 2025. Bangladesh Agricultural Research Council.