Agricultural Research Management Information System

  • Home
  • Research Summary
    • All
    • Government Organization
      • Agriculture Training Institute, Ishwardi, Pabna
      • Bangabandhu academy for poverty alleviation and rural development (BAPARD)
      • Bangabandhu Sheikh Mujibur Rahman Science & Technology University
      • Bangladesh Bureau of Statistics
      • Bangladesh Institute of Health Sciences
      • Bangladesh Institute of Tropical & Infections Diseases (BITID)
      • Bangladesh Meteorological Department
      • Bangladesh National Herbarium
      • Bangladesh Space Research and Remote Sensing Organization
      • Bangladesh Technical Educational Board
      • Barind Multipurpose Development Authority
      • Central Cattle Breeding Station
      • Department of Agriculture Extension
      • Department of Fisheries
      • Department of Livestock Services
      • Department of Youth Development
      • Dhaka Medical College
      • Geological Survey of Bangladesh
      • Institute of Epidemiology, Disease Control & Research
      • Jatiya Kabi Kazi Nazrul Islam University
      • Khulna Govt. Women College
      • Livestock Training Institute
      • Local Government Engineering Department
      • Ministry of Agriculture
      • Ministry of Environment and forest
      • Ministry of Fisheries and Livestock
      • Ministry of Labour & Employement
      • Ministry of Land
      • Ministry of Public Administration
      • Ministry of Textiles and Jute
      • Ministry of Water Resources
      • Ministry of Youth and Sports
      • National Agricultural Training Academy
      • National institute of preventive and social medicine
      • National Mushroom Development and Extension Centre
      • Pabna University of Science and Technology
      • Seed Certification Agency
      • Shaheed Suhrawardy Medical College
      • Sheikh Hasina University
      • University Grants Commission
      • Youth Training Centre
    • Autonomous/Semi-gov Org
      • Bangladesh Academy for Rural Development
      • Bangladesh Agricultural Development Corporation
      • Bangladesh Atomic Energy Commission
      • Bangladesh Council of Scientific and Industrial Research
      • Bangladesh Fisheries Development Corporation
      • Bangladesh Institute of Development Studies
      • Bangladesh Institute of Management
      • Bangladesh Milk Producers Cooperative Union Limited
      • Bangladesh Water Development Board
      • BIRDEM
      • Center for Environmental and Geographic Information Services
      • Hortex Foundation
      • Institute of Water Modeling
      • National Institute of Biotechnology
      • River Research Institute
      • Rural Development Academy
    • NARS
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Public University
      • Ahsanullah University of Science and Technology
      • Bangabandhu Sheikh Mujibur Rahman Agricultural University
      • Bangamata Sheikh Fojilatunnesa Mujib Science and Technology University
      • Bangladesh Agricultural University
      • Bangladesh Open University
      • Bangladesh University of Engineering and Technology
      • Bangladesh University of Professionals
      • Bangladesh University of Textiles
      • Barisal Government Veterinary College
      • Begum Rokeya University
      • Chittagong University of Engineering and Technology
      • Chittagong Veterinary and Animal Science University
      • Comilla University
      • Dhaka University of Engineering & Technology
      • Dinajpur Government Veterinary College, Dinajpur
      • Gono Bishwabidyalay
      • Hajee Mohammad Danesh Science and Technology University
      • Islamic University, Kushtia
      • Jagannath University
      • Jahangirnagar University
      • Jessore University of Science and Technology
      • Jhenaidha Government Veterinary College
      • Khulna Agricultural University
      • Khulna University
      • Khulna University of Engineering & Technology
      • Mawlana Bhashani Science and Technology University
      • Millitary Institute of Science and Technology
      • National University
      • Noakhali Science and Technology University
      • Patuakhali Science and Technology University
      • Rajshahi University of Engineering and Technology
      • Shahjalal University of Science & Technology
      • Sher-e-Bangla Agricultural University
      • Sylhet Agricultural University
      • Sylhet Government Veterinary College
      • University of Barisal
      • University of Chittagong
      • University of Dhaka
      • University of Rajshahi
    • Private University
      • Asian University of Bangladesh
      • Atish Dipankar University of Science and Technology
      • BGC Trust University Bangladesh
      • BGMEA University of Fashion & Technology (BUFT)
      • BRAC University
      • City University
      • Daffodil International University
      • East West University
      • Exim Bank Agricultural University
      • Gana Bishwabiddalaya
      • Hamdard University
      • Independent University, Bangladesh
      • International Islamic University Chittagong
      • International University of Business Agriculture and Technology
      • Islamic University of Technology
      • Leading University, Sylhet
      • North South University
      • Premier University
      • Primeasia University
      • Private University
      • SOAS, University of London
      • Southeast University
      • Stamford University
      • State University of Bangladesh
      • The Millenium University
      • University of Asia Pacific
      • University of Development Alternative
      • University of Information Technology and Sciences
      • University of Liberal Arts Bangladesh
      • University of Science and Technology, Chittagong
      • World University
    • INGO/IO/NGO/Private Org
      • ACI Limited
      • Agricultural Advisory Society (AAS)
      • Apex Organic Industries Limited
      • Arannayk Foundation
      • Bangladesh Academy of Sciences
      • Bangladesh Centre for Advanced Studies
      • Bangladesh Institute of Social Research
      • Bangladesh Science Foundation
      • Bangladesh Unnayan Parishad
      • BAPA
      • BRAC
      • CARE Bangladesh
      • CARITAS
      • Centre for Environmental Geographical Information System
      • Centre for Policy Dialogue (CPD)
      • Creative Conservation Alliance
      • Dhaka Ahsania Mission
      • Dwip Unnayan Sangstha
      • EMBASSY OF DENMARK, BANGLADESH
      • Energypac Limited Bangladesh
      • FAO- Bangladesh
      • FIVDB
      • ICDDRB, Mohakhali, Dhaka-1212
      • iDE Bangladesh
      • Innovision Consulting Private Ltd.
      • International Center for Climate Change and Development
      • International Centre for Integrated Mountain Development
      • International Development Research Centre
      • International Fertilizer Development Center, Bangladesh
      • International Food Policy Research Institute
      • International Maize and Wheat Improvement Centre
      • International Potato Center
      • IRRI- Bangladesh
      • IRRI-Philippines
      • Ispahani Agro LTD
      • IUCN, Bangladesh
      • Krishi Gobeshina Foundation
      • Lal Teer
      • Mennonite Central Committee
      • Metal (Pvt.) Ltd
      • Modern Herbal Group
      • Palli Karma-Sahayak Foundation
      • Practical Action Bangladesh
      • Proshika
      • RDRS Bangladesh
      • RIRI-Philippines
      • Rothamsted Research
      • SAARC Agricultural Centre
      • SAARC Meteorological Research Centre
      • Social Upliftment Society
      • South Asia Enterprise Development Facility
      • Square Pharmaceuticals Ltd.
      • Supreme Seed
      • Transparency International Bangladesh
      • Unnayan Onneshan
      • USAID
      • Water Resources Planning Organization
      • Winrock International
      • World Bank
      • World Food Program
      • World Vegetable Center
      • WorldFish Centre, Bangladesh
    • Foreign University
      • Asian Institute of Technology
      • Auckland University of Technology
      • Australian National University
      • Bidhan Chandra Krishi Viswavidyalaya
      • BOKU-University of Natural Resources and Applied Life Sciences
      • Cranfield University
      • Curtin University
      • Foreign University/ Institute
      • Hiroshima University
      • Hokkaido University
      • Huazhong Agricultural University
      • International Islamic University, Malaysia
      • Kagawa University
      • Kangwon National University
      • Kochi University
      • Kyoto University
      • Kyushu University
      • Ladoke Akintola University of Technology
      • Murdoch University
      • Nagoya University
      • NOAA-CREST, CCNY
      • Royal Veterinary and Agricultural University
      • San Diego State University
      • Shinshu University
      • Tottori University
      • United Nations University
      • University Malaysia Kelantan
      • University Malaysia Pahang
      • University Nova de Lisboa
      • University of Alberta
      • University of Bremen
      • University of Bremen
      • University of Calgary
      • University of california
      • University of Greenwich
      • University of Hamburg, Hamburg
      • University of Hannover
      • University of Hawaii
      • University of Helsinki, Finland
      • University of Kalyani
      • University of Leeds
      • University of Liverpool
      • University of Malaya
      • University of Milan
      • University of New England
      • University of Philippines
      • University of Plymouth
      • University of Queensland
      • University of Reading
      • University of Southampton
      • University of Texas
      • University of the Punjab
      • University of Tokyo
      • University of Toronto
      • University of Wales
      • University of Washington
      • University of Wollongong
      • University Putra Malaysia
      • University Sains Malaysia
  • Search
    • Search by Keyword
    • Search by Organization
    • Search by Program Area
    • Search by Commodity/Non-commodity
    • Search by Funding Source
    • Search by Researcher
    • Custom Search
    • On-going Research
  • About Us
    • ARMIS
    • Brochure
  • Contact Us
    • BARC Personnel
    • ARMIS Personnel
    • Feedback
  • Report
    • All
    • By Organization
      • Bangladesh Agricultural Research Council
      • Bangladesh Agricultural Research Institute
      • Bangladesh Fisheries Research Institute
      • Bangladesh Forest Research Institute
      • Bangladesh Institute of Nuclear Agriculture
      • Bangladesh Jute Research Institute
      • Bangladesh Livestock Research Institute
      • Bangladesh Rice Research Institute
      • Bangladesh Sericulture Research and Training Institute
      • Bangladesh Sugarcrop Research Institute
      • Bangladesh Tea Research Institute
      • Bangladesh Wheat and Maize Research Institute
      • Cotton Development Board
      • Soil Resource Development Institute
    • Research Trend Analysis
  • User Request
  • Data Input
  • Help
    • Operation Manual
      • PDF
      • Video
    • Program Area & Commodity
  • We have reached 37600 number of research entries at this moment.
    • Logout

Research Detail

  1. Home
  2. Research
  3. Detail
E. H. Khokan
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

A. Haydar
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

T. Ara
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

M. D. Sharma
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

M. K. Alam
Regional Agricultural Research Station, BARI, Ishurdi, Pabna, Bangladesh

The experiment was conducted at plant breeding and gene engineering laboratory, Department of Botany, Rajshahi University, Rajshahi during 2008-09 to establish an Agrobacterium tumefaciens mediated transformation procedure for Solanum tuberosum. For increasing the iron storage in the potato, explants (in vitro and ex vitro leaf and internode) were incubated with Agrobacterium tumefaciens strain LBA4404 bearing Ti based binary pCAMBIA2301 plasmid containing selectable marker neomycin phosphotransferase (nptII) and ferritin gene. Following co-cultivation explants were cultured on selective medium containing 50 mg/l Kanamycin + 50 mg/l Cefotaxime. Kanamycin resistant shoots were induced from explants after 5-6 weeks. Shoot regeneration was achieved after transferring the tissue on to fresh medium of same combination and the shoots were rooted on MS medium containing 50 mg/l kanamycin. Incorporation and expression of the transgenes were confirmed by PCR and RT-PCR analysis. Transgenic potato could be developed with ferritin gene using this protocol.

  Agrobacterium, Heme protein, Ferritin gene, Transformation method
  Plant breeding and gene engineering laboratory, Department of Botany, Rajshahi University, Rajshahi
  30-11-2007
  30-11-2008
  Postharvest and Agro-processing
  Potato

To develop of transgenic potato plants with ferritin construct with Agrobacterium-mediated transformation.

The experiment was conducted at plant breeding and gene engineering laboratory, Department of Botany, Rajshahi University, Rajshahi during 2008-09. Plant material: Following two different types of explants of potato cv. Cardinal were used. (i) Third leaf and the internodes of in-between 3rd and 4th leaves of 28-days old field grown plants.(ii) Leaves and internodes (4th, 3rd and 2nd leaves) and to corresponding internodes of 21 days old in vitro grown plants. Agrobacterium strain and plasmid: Agrobacterium tumefaciens strain LBA4404 contains binary plasmid pCAMBIA-2301 was used. cDNA sequence of ferritin gene was inserted into LBA4404 Ti plasmid under the control of 35S promoter and Nos terminator to develop pCAMBIA-2301 plasmid. The recombinant vector pCAMBIA-2301 was transferred from Escherichia coli DH5α into A. tumefaciens LBA4404 by triparentalmating and was received from Professor M. Monzur Hossain, Plant Breeding and Gene Engineering Lab., Dept. of Botany, University of Rajshahi, Bangladesh.  Tissue culture condition: In ex vitro condition, young leaves and internodes of field grown potato plants were collected and surface sterilized with 0.1% Hgcl2 for 3 minutes, washed thrice with distilled water. In in vitro condition, explants from aseptically grown 21 days old seedlings were excised and cultured onto MS basal medium. All plant media were adjusted with 1N NaOH to pH 5.7, solidified with 6gm/l agar and autoclaved at 1210 for 20 min. Transformation of explants: Explants were inoculated with Agrobacterium tumefaciens strain LBA4404 containing pCAMBIA-2301 plasmid having ferritin gene in liquid MS medium with 50 mg/l kanamycin for 30-90 sec. The density of Agrobacterium inoculums of 0.50-2.00 at 600 nm and co-cultivation for 24-48 h on agar gelled MSo medium. After, co-cultivation the explants were transferred and placed on selection and regeneration medium (MS+1.0 mg/lNAA+0.5 mg/l BA+50 mg/l kanamycin+50 mg/l cefotaxime). After 5-6 weeks shoots began to regenerate in selection medium from the cut surface of the explants and transferred on to same fresh medium for shoot induction. Kanamycin resistant shoots were transferred to MS basal medium supplemented with 50 mg/l kanamycin for shooting. PCR and RT-PCR analysis: To detect the transgene in transformed and control (Non-transformed) plants were analysed by the polymerase chain reaction (PCR) and its transcripts by reverse transcriptase polymerase chain reaction (RT-PCR). Genomic DNA of potato was extract from young leaves. PCR analysis to detect the presence of the ferritin gene were carried out using the PCR Screening Kit (Sigma Chemicals Ltd., USA) in the presence of following pair of primers forward primer (5´GTTGCTCTCAAGGGACTTGC3´) and reverse primer (5´CACACACCGTGACCCTTTC 3). Amplification condition was 94 °C for 4 min followed by 35 cycles of 94 °C 1 min, 55 °C 1 min, 72 °C 1.30 min and 72 °C 10 min for final extension. Expected PCR product size was about 365 bps. Ferritin transcripts analyzed were carried out to confirm the transgenic status of plants showing a positive reaction in RT-PCR analysis. Total RNA was isolated from the transgenic plants according to the manufacture’s instructions (Quagene, UK). First strand cDNA synthesis with poly-T proimers and subsequent cDNA amplification with the target gene specific primers were done with RTPCR kits (Applied Biosystem, UK) according to suppliers manual. Amplified cDNA were on 1.8 % agarose gel, stained with ethidium bromide and documented.

  Int. J. Sustain. Crop Prod. 4(4):17-22, 2009
  
Funding Source:
1.  Government Budget:  
  

In summary, this finding suggests that the potato with enhanced iron content developed by genetic transformation may contribute to solve the iron deficiency nutritional problem of the population that consumes potato as a major food.

  Journal
  


Copyright © 2025. Bangladesh Agricultural Research Council.