Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Enhancement of Agrobacterium-mediated Transformation Method for the Production of Heme-protein (ferritin Protein) Rich Potato

E. H. Khokan
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

A. Haydar
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

T. Ara
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

M. D. Sharma
Plant Breeding and Genetic Engineering Laboratory, Department of Botany, University of Rajshahi, Rajshahi-6205, Bangladesh

M. K. Alam
Regional Agricultural Research Station, BARI, Ishurdi, Pabna, Bangladesh

Abstract/ Executive Summary:

The experiment was conducted at plant breeding and gene engineering laboratory, Department of Botany, Rajshahi University, Rajshahi during 2008-09 to establish an Agrobacterium tumefaciens mediated transformation procedure for Solanum tuberosum. For increasing the iron storage in the potato, explants (in vitro and ex vitro leaf and internode) were incubated with Agrobacterium tumefaciens strain LBA4404 bearing Ti based binary pCAMBIA2301 plasmid containing selectable marker neomycin phosphotransferase (nptII) and ferritin gene. Following co-cultivation explants were cultured on selective medium containing 50 mg/l Kanamycin + 50 mg/l Cefotaxime. Kanamycin resistant shoots were induced from explants after 5-6 weeks. Shoot regeneration was achieved after transferring the tissue on to fresh medium of same combination and the shoots were rooted on MS medium containing 50 mg/l kanamycin. Incorporation and expression of the transgenes were confirmed by PCR and RT-PCR analysis. Transgenic potato could be developed with ferritin gene using this protocol.

Keywords: Agrobacterium, Heme protein, Ferritin gene, Transformation method

Location: Plant breeding and gene engineering laboratory, Department of Botany, Rajshahi University, Rajshahi

Start Date: 30-11-2007

End Date: 30-11-2008

Program Area: Postharvest and Agro-processing

Commodity: Potato

Objectives:

To develop of transgenic potato plants with ferritin construct with Agrobacterium-mediated transformation.

Methodology:

The experiment was conducted at plant breeding and gene engineering laboratory, Department of Botany, Rajshahi University, Rajshahi during 2008-09. Plant material: Following two different types of explants of potato cv. Cardinal were used. (i) Third leaf and the internodes of in-between 3^rd and 4th leaves of 28-days old field grown plants.(ii) Leaves and internodes (4th, 3rd and 2nd leaves) and to corresponding internodes of 21 days old in vitro grown plants. Agrobacterium strain and plasmid: Agrobacterium tumefaciens strain LBA4404 contains binary plasmid pCAMBIA-2301 was used. cDNA sequence of ferritin gene was inserted into LBA4404 Ti plasmid under the control of 35S promoter and Nos terminator to develop pCAMBIA-2301 plasmid. The recombinant vector pCAMBIA-2301 was transferred from Escherichia coli DH5α into A. tumefaciens LBA4404 by triparentalmating and was received from Professor M. Monzur Hossain, Plant Breeding and Gene Engineering Lab., Dept. of Botany, University of Rajshahi, Bangladesh. Tissue culture condition: In ex vitro condition, young leaves and internodes of field grown potato plants were collected and surface sterilized with 0.1% Hgcl₂ for 3 minutes, washed thrice with distilled water. In in vitro condition, explants from aseptically grown 21 days old seedlings were excised and cultured onto MS basal medium. All plant media were adjusted with 1N NaOH to pH 5.7, solidified with 6gm/l agar and autoclaved at 1210 for 20 min. Transformation of explants: Explants were inoculated with Agrobacterium tumefaciens strain LBA4404 containing pCAMBIA-2301 plasmid having ferritin gene in liquid MS medium with 50 mg/l kanamycin for 30-90 sec. The density of Agrobacterium inoculums of 0.50-2.00 at 600 nm and co-cultivation for 24-48 h on agar gelled MSo medium. After, co-cultivation the explants were transferred and placed on selection and regeneration medium (MS+1.0 mg/lNAA+0.5 mg/l BA+50 mg/l kanamycin+50 mg/l cefotaxime). After 5-6 weeks shoots began to regenerate in selection medium from the cut surface of the explants and transferred on to same fresh medium for shoot induction. Kanamycin resistant shoots were transferred to MS basal medium supplemented with 50 mg/l kanamycin for shooting. PCR and RT-PCR analysis: To detect the transgene in transformed and control (Non-transformed) plants were analysed by the polymerase chain reaction (PCR) and its transcripts by reverse transcriptase polymerase chain reaction (RT-PCR). Genomic DNA of potato was extract from young leaves. PCR analysis to detect the presence of the ferritin gene were carried out using the PCR Screening Kit (Sigma Chemicals Ltd., USA) in the presence of following pair of primers forward primer (5´GTTGCTCTCAAGGGACTTGC3´) and reverse primer (5´CACACACCGTGACCCTTTC 3). Amplification condition was 94 °C for 4 min followed by 35 cycles of 94 °C 1 min, 55 °C 1 min, 72 °C 1.30 min and 72 °C 10 min for final extension. Expected PCR product size was about 365 bps. Ferritin transcripts analyzed were carried out to confirm the transgenic status of plants showing a positive reaction in RT-PCR analysis. Total RNA was isolated from the transgenic plants according to the manufacture’s instructions (Quagene, UK). First strand cDNA synthesis with poly-T proimers and subsequent cDNA amplification with the target gene specific primers were done with RTPCR kits (Applied Biosystem, UK) according to suppliers manual. Amplified cDNA were on 1.8 % agarose gel, stained with ethidium bromide and documented.

Source of Information: Int. J. Sustain. Crop Prod. 4(4):17-22, 2009

Article Link (Online Journal):

Funding Source:

1. Government

Budget:

Total Budget (Tk.) :

Achievement/Findings:

In summary, this finding suggests that the potato with enhanced iron content developed by genetic transformation may contribute to solve the iron deficiency nutritional problem of the population that consumes potato as a major food.

Knowledge Management: Journal