Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Molecular Identification and Sexual Differentiation of Freshwater Mud Eel, Monopterus Cuchia

Md. Faruque Miah
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Fahmida Haque
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Mohammad Robin Mia
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Enaya Jannat
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

Hafij Ali
Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh

M. M. A. Quddus
Department of Zoology, University of Dhaka, Bangladesh

Kawser Ahmed
Department of Oceanography, University of Dhaka, Bangladesh

Abstract/ Executive Summary:

This study was carried out for molecular identification and sexual differentiation of freshwater mud eel, Monopterus cuchia which is most important for induced breeding. Traditional classification of freshwater eels has always been obscurerd and unreliable due to their morphological ambiguity. A rapid and cost effective molecular markers, mitochondrial 16S rRNA and glutamine synthetase gene was used to establish molecular standards for identification of this fish. Similar bands were seen in all the individuals at the level of 250bp length by using 16s mitochondrial DNA of 24 individuals and 544bp length for partial sequence of glutamine synthetage gene in 11 individuals. A successful protocol was developed to identify male and female M. cuchia through morphological, anatomical and histological analysis.

Keywords: 16s Mt NA, Gsase Gene, Molecular Identification, Sexual Differentiation, Monopterus Cuchia

Location: Genetic Engineering and Biotechnology at Shahjalal University of Science and Technology, Sylhet

Start Date:

End Date:

Program Area: Variety and Species

Commodity: Eel

Objectives:

To study the identification and sexual differentiation of freshwater Mud Eel, Monopterus cuchia.

Methodology:

Collection of Fish: Fish samples were collected by fisherman from “Tanguar Haour”, Sunamganj and then identified through morphological characteristics. Collected fish samples were brought to the laboratory of Genetic Engineering and Biotechnology at Shahjalal University of Science and Technology, Sylhet, Bangladesh and were kept into glass aquariums until tissue isolation for molecular and histological analysis as well as for studying external and internal anatomy. Molecular Identification: DNA extraction Each fish was dissected and different tissue samples (i.e. liver, kidney etc.) were isolated and washed with distilled water and 70% alcohol. Then, the tissues were preserved separately in 100% alcohol at -20^oC. DNA extraction was carried out by using a commercially available kit, Bioserve, CAT.NO.2025. A total of 24 fish samples were used for DNA extraction and extracted DNA samples were stored at -20ºc. The quality of DNA was checked by electrophoresis on 0.8% agarose gel comparing with 30bp long lamda DNA. The gel was run at 70 V for 40 minutes dying with ethedium bromide solution. Finally, photographs were taken by digital camera using gel documentation system. PCR amplification: Vertebrate universal primer, accession no. 16SrRNA L2513 (5’ GCCTGTTTACCAAAAACATCAC 3’) and accession no. 16SrRNAH2714 (5’ CTCCATAGGGTCT TCTCGTCTT 3’) as well as gene specific primer of glutamine synthetase, accession no. GSase 152041 (5’ GAGGGCTCCAACAGCGATATGTA 3’) and accession no. GSase 152042 (5’ CTGAAGTTTGTATGGCAGCC AGC 3’) were used to identify the species. PCR reaction was done for both the primers with 25μl of master mix for each sample. In this experiment PCR reaction of 16s mitochondrial DNA was conducted by 40 cycles with preheated at 94ºC for 3 minutes followed by denaturation at 94ºC for 1 minute, annealing at 58ºc for 1 minute and 2 minutes for extension at 72ºC. A final step of 7 min for 72ºC was added to allow complete extension of the amplified fragments. PCR amplification of glutamine synthetage gene was maintained like 16s mtDNA, where denaturation at 94°C for 1 min. and annealing temperature at 64⁰C for 1 min. and run with 35 cycles. Amplified products were stored at -20ºC. The amplified DNA fragments were separated on 1.2% agarose gel for 40 minutes at 70V comparing with 1000 bp ladder. Next, the photographs were taken by a digital camera using gel documentation system. Sexual Differentiation: Male and female were identified by morphological, internal anatomy and histological analysis. Note that, Morphological study was observed by naked eye with important characteristics. Specifically, some measuring parameters were analyzed using measuring scale and lifting balance. Different internal organs especially gonads, liver, kidney and intestine were observed through dissection process. Also, gonad shape, size, length etc. and sperm duct or oviduct was analyzed. Moreover, the number of mature eggs in the oviduct was also counted. We, at the same time, studied the histological analysis of gonads using microtomy.

Source of Information: Universal Journal of Agricultural Research 1(3): 54-58, 2013

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

Sexual differentiation of this species was established through morphometric and histological analysis for suitable differentiation between male and female fish.

Knowledge Management: Journal