Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Proteolytic Bacillus Spp. Associated with Tannery Industries: Conventional and Molecular Identification

Mihir Lal Saha
Department of Botany, University of Dhaka, Dhaka-1000, Bangladesh

Tahsin Khan
Department of Botany, University of Dhaka, Dhaka-1000, Bangladesh

Md Mostafa Kamal
Department of Botany, University of Dhaka, Dhaka-1000, Bangladesh

Mohammad Nurul Islam
Department of Botany, University of Dhaka, Dhaka-1000, Bangladesh

Abstract/ Executive Summary:

Samples collected from different stages of the tannery industry were found to be alkaline (pH 7.52 to 12.11). A good number of bacteria were found to be associated with the samples. The bacterial count ranged in between 1.34×10⁵ to 3.44×10⁵ cfu/ml and 1.04×10⁵ to 6×10⁵ cfu/ml on nutrient agar (NA) and peptone yeast extract glucose agar (PYG) medium, respectively. The maximum bacterial count was observed in bating stage while the minimum count was in the deliming stage. Primarily, 70 isolates were selected based on their different colonial morphology. After heat shock test 27 isolates were finally selected for identification and proteolytic potential. All the selected isolates were the members of different species of the genus Bacillus. The conventionally identified species were B. stearothermophilus (9), B. subtilis (4), B. brevis (3), B. pumilus (3), B. alcalophilus (2), B. badius (2), B. firmus (2) and B. lentus (2). Four important proteolytic isolates of Bacillus were selected for molecular identification. The isolates were confirmed as Bacillus subtilis strain B20 (L/P/2/1), B. subtilis strain PB18 (D/P/3/1), Bacillus sp. strain BVC38 (D/P/3′/2) and B. amyloliqefaciens strain Egy25 (B/N/3′/1). Except B/N/3′/1 all the conventional identification was in accordance with the molecular identification as the isolate B/N/3′/1 was conventionally identified as B. pumilus (B/N/3′/1). All the isolates showed positive proteolytic activities on skim milk agar and the zone ratio was in between 2.61 ± 0.44 and 6.42 ± 0.95. These isolates could be commercially utilized in the tannery and detergent industries for their proteolytic activity.

Keywords: Bacteria, Bacillus, Tannery, Protease, Identification

Location: Dhaka Metropolitan city, Bangladesh

Start Date:

End Date:

Program Area: Risk Management in Agriculture

Commodity: Diseases

Objectives:

To isolate and identify Bacillus spp. associated with tannery industries and having proteolytic potential.

Methodology:

Hazaribagh tannery industries of Dhaka Metropolitan city, Bangladesh were selected for the present study. Samples were collected from the four selected stages viz. soaking, liming, deliming and bating. Sample water was collected in sterile plastic bottles sterilized with alcohol. The pH of the collected samples was measured in the laboratory by a pH meter (HM-31P, DKK-TOA Corp., Japan). Nutrient agar (NA) and peptone yeast extract glucose agar (PYG) media were used for the enumeration and isolation of aerobic heterotrophic bacteria present in samples. The pH of the medium was adjusted to 8.5. Enumeration and isolation of aerobic heterotrophic bacteria were carried out by serial dilution technique. The inoculated plates were inverted and incubated at 37°C for 48 hrs in an incubator (Memmert GmbH + Co Kg 8540 Sehwabach). After 48 hrs of incubation the plates having well discrete colonies were selected for counting. Using colony counter (Digital colony counter, DC-8 OSK 100086, Kayagaki, Japan) the developed colonies were counted. Preliminary selection of the isolates was made on the basis of their distinctive colony morphology. Heat-shock test was done for confirmation of spore former bacteria representing Bacillus spp. Bacteria grown on three different protein based media (Gelatin medium, Coagulated egg medium and Skim milk agar medium) were used for their proteolytic activity. For conventional identification important biochemical tests were carried out viz. carbohydrate fermentation, catalase, deep glucose agar, tyrosine degradation, egg-yolk lecithinase, starch hydrolysis, methyl red, nitrate reduction, citrate utilization, oxidase etc. Following Bergey’s Manual (Sneath et al. 1986) conventional identification was done. Proteolytic activity was determined by the zone ratio on skim milk agar (SMA). For this purpose 1 ml of sterilized milk was mixed with nutrient agar in sterilized Petri plate and allowed to solidify. Each of the isolates was point inoculated on SMA plate using sterilized inoculation needle and incubated at 37°C for 24 hrs. The isolates forming clear zone around the colonies were determined by mm scale. The following formula was used to determine the zone ratio. Zone ratio = Zone diameter (mm)/Colony diameter (mm) Potential four proteolytic isolates were taken for molecular identification based on 16S rDNA sequence analysis. For the partial amplification of 16S rDNA gene the following primer pairs were used- 5'-16S rRNA: CCAGACTCCTACGGGAGGCAGC, 3'-16S rRNA: CTTGTGCGGGC CCCCGTCAATTC. Supernatant of heat lysed cell suspension was used as the source of template DNA for PCR amplification of 16S rRNA gene. After completion of cycling program, the reactions were held at 4ºC. The amplified products were separated electrophoretically on 1% agarose gel. DNA bands were observed on UV- transilluminator and photographed by a Gel Documentation system (Microdoc DI-HD, MUV21- 254/365, Cleaver Scientific). The sequence generated from automated sequencing of PCR products were analyzed through NCBI-BLAST database (http://blast.ncbi.nlm.nih.gov/) and rRNA BLAST (h ttp://bioin for matics.p sb.ug en t.be/ cgi - bin /r RNA/ bl astfor m.cgi ) programs to find out possible similar organism through alignment of homologous sequences.

Source of Information: Bangladesh J. Bot. 44(4): 557-564, 2015 (December)

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

The present findings showed that a varied species of Bacillus was found to be associated with the leather processing industries. The isolated Bacillus spp. clearly indicated a significant variety of proteolytic activity and these Bacillus spp. would be a good source of proteases for leather processing industries. More researches are to be needed for these isolated bacteria and optimization of their enzyme production as well as commercial utilization.

Knowledge Management: Journal