Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Prevalence of Multi-drug Resistant Bacteria in Selected Street Food and Water Samples

Anika Tabassum
Department of Botany, Jagannath University, Dhaka -1100, Bangladesh

Mihir Lal Saha
Department of Botany, University of Dhaka, Dhaka 1000, Bangladesh

Mohammad Nurul Islam
Department of Botany, University of Dhaka, Dhaka 1000, Bangladesh

Abstract/ Executive Summary:

Present study was conducted to determine the bacteria and their multi-drug resistance pattern of Velpuri and water of Velpuri shop of different areas of Dhaka city. A total of 74 bacteria were isolated of which 26 isolates were subjected for further study. Eleven and 15 isolates from 26, were found Gram-positive and Gram-negative bacteria, respectively. Three isolates of Gram-positive bacteria were found rod shaped and spore formers which were identified as Bacillus spp. while eight isolates were found round shaped and non- spore formers and identified as Staphylococcus, Streptococcus, Planococcus, Micrococcus. In case of Gram- negative bacteria, Alcaligenes, Escherichia, Pseudomonas, Enterobacter, Proteus, Klebsiella, Yersinia were found to be associated with the samples. Among 26 isolates Pseudomonas and Planococcus were found to be dominating genera. Besides provisional identification, four selected isolates were further confirmed through molecular characterization based on 16S rDNA sequence analysis. Antibiotic sensitivity test results revealed that isolated bacteria were resistant against common antibiotics like penicillin G (80.77%), vancomycin (61.53%) and rifampicin (57.70%). Among the isolates Pseudomonas, Enterobacter cloacae, Eshcherichia coli, Klebsiella, Proteus morganii, Yersinia enterocolitica were found to be multi-drug resistant which is very much alarming for the consumers.

Keywords: Velpuri, Bacteria, Antibiotic, Multi-drug resistance

Location: Dhaka city viz., Moghbazar (MB), Dhaka Medical College (DMC), Bangladesh University of Science and Technology (BUET), Kalabagan (KB), Mirpur-1 (MP-1), Teacher Students Centre (TSC), Jagannath University campus (JU), Chankharpul (CP), Curzon Hall (CH), Science Annex (SA) and Udayan School (US), etc.

Start Date:

End Date:

Program Area: Food Safety and Security

Commodity: Organic products, Water quality

Objectives:

To determine the Prevalence of Multi-Drug Resistant Bacteria in Selected Street Food and Water Samples.

Methodology:

Samples were collected from different sites of Dhaka city viz., Moghbazar (MB), Dhaka Medical College (DMC), Bangladesh University of Science and Technology (BUET), Kalabagan (KB), Mirpur-1 (MP-1), Teacher Students Centre (TSC), Jagannath University campus (JU), Chankharpul (CP), Curzon Hall (CH), Science Annex (SA) and Udayan School (US). Samples were collected in sterile containers and brought to the laboratory immediately for bacteriological analysis. Microbiological analysis were carried out by ten-fold serial dilution (Greenberg et al. 1998) and plated on nutrient agar, MacConkey agar, Salmonella-Shigella (SS) agar, and Cetrimide agar media were used for isolation of bacterial strains. The morphological, cultural and biochemical studies of the selected isolates were done following standard laboratory manuals. Antibiotic susceptibility test was performed by the Kirby-Bauer disc diffusion method on Mueller- Hinton agar plate (Hudzicki 2012). After incubation at 37°C for 24 hrs, zone diameter around the disc was measured and isolates were classified as susceptible (S), intermediately resistant (I) and resistant (R). Nine antibiotics viz., penicillin (10 U), neomycin (30 µg), gentamycin (10 µg), streptomycin (10 µg), doxycyclin (30 µg), ciprofloxacin (5 µg), vancomycin (30 µg), rifampicin (5 µg), polymyxin B (300 U) were tested. Four conventionally identified isolates were subjected to molecular identification based on 16S rDNA sequence analysis for further confirmation. The following primer pairs were used- 5'- 16S rRNA: CCAGACTCCTACGGGAGGCAGC, 3'-16S rRNA: CTTGTGCGGGCCCCCGT ?CAATTC for the partial amplification of 16S rRNA gene. Supernatant of heat lysed cell suspension was used as the source of template DNA during PCR amplification of 16S rRNA gene. The PCR reaction was performed following an initial denaturation at 95ºC for 5 mins., denaturation at 94ºC for 1 min., annealing at 55ºC for 30 sec., extension at 72ºC for 1 min., and final extension was at 72ºC for 10 mins. After completion of cycling program, the reactions were held at 4ºC. The amplified products were separated electrophoretically on 1% agarose gel. DNA bands were observed on UV-transilluminator and photographed by a gel documentation system (Microdoc DI-HD, MUV21-254/365, Cleaver Scientific). The sequence generated from automated sequencing of PCR products were analyzed through NCBI-BLAST database (http://blast. ncbi.nlm.nih.gov/) and rRNA BLAST (http://bioinformatics.psb.ugent.be/cgi-bin/rRNA/ blastform.cgi) programs to find out possible similar organism through alignment of homologous sequences.

Source of Information: Bangladesh J. Bot. 44(4): 621-627, 2015 (December)

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

Results of the culture and sensitivity (C/S) test of the Gram negative bacteria were shown. Gram-negative bacteria associated with the samples were found to be resistant against common antibiotics like rifampicin, penicillin G and vancomycin. Pseudomonas syringae was found to be resistant against five antibiotics tested viz. Rifampicin, penicillin G, vancomycin, doxycyclin and ciprofloxacin. In case of Gram-positive bacteria the results were found to be different and most of the Gram positive bacteria were susceptible against common antibiotics tested. In a study, Ali et al. (2011) observed that bacteria associated with RTE fresh vegetables and fruits most were resistant to penicillin and vancomycin. In the present study similar result was observed. The result clearly indicated that waterborne pathogens are becoming resistant to penicillin and vancomycin. Multidrug-resistant enteric bacteria were isolated from Turkey, cattle, and chicken farms and retail meat products in Oklahoma. A total of 132 isolates of Klebsiella pneumoniae were characterized and all isolates were found to be resistant to ampicillin, tetracycline, streptomycin, gentamycin, and kanamycin (Kim et al. 2005). In the present study Klebsiella pneumoniae was found to be resistant against rifampicin, penicillin G and vancomycin and Klebsiella sp. In this study Pseudomonas syringae showed resistance against five antibiotics. Among the isolated bacteria Pseudomonas, Enterobacter cloacae, Eshcherichia coli, Klebsiella, Proteus morganii, Yersinia enterocolitica were found to be multidrug resistant. The presence of both Gram-negative and Gram-positive members viz. E. coli, Enterobacter, Klebsiella, Alcaligenes, Staphylococcus, Streptococcus etc. in Velpuri a popular snacks and their multi-drug resistance raises serious food and water safety concerns.

Knowledge Management: Journal