Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Predator Performance of Coccinella Transversalis and Its Molecular Identification

Susmita Sarker
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Abdul Jabber Howlader
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Faria Farhana Rain
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Abu Faiz Md Aslam
Department of Zoology, Jahangirnagar University, Savar, Dhaka- 1342, Bangladesh

Abstract/ Executive Summary:

Predatory efficacy of Coccinella transversalis (Coleoptera: Coccinellidae) on three detrimental agriculturally important aphids (Aphis craccivora, A. fabae and A. gossypii) was studied under laboratory condition. The 4^th instar larvae of C. transversalis consumed highest (21.56 ± 1.72) number of A. craccivora aphids followed by A. fabae (12.33 ± 1.74) and A. gossypii (13.99 ± 0.77). Life cycle studies of C. transversalis on the above three aphid species revealed that it took maximum (27.66 ± 3.06) days to complete life cycle while reared on A. craccivora followed by A. fabae (25.66 ± 0.58 days) and A. gossypii (22.33 ± 1.52 days) respectively. As C. transversalis is a potential predator, an attempt was taken to identify this biological control agent based on mitochondrial cytochrome c oxidase (COI) gene sequence. Sequenced gene was submitted to the NCBI GenBank database (Accession NO. MG 587947.1) followed by proper procedure. Phylogenetic relationship of the beetle was constructed based on mitochondrial COI gene. The nucleotide composition analysis revealed that the value of A+T (69.3%) was greater than G+C (30.7%). Such study of C. transversalis would be helpful in biological control programme of aphid pest.

Keywords: Coccinella transversalis, Predatory efficacy, DNA barcode, Molecular Identification

Location: Experimental Station, Department of Zoology, Jahangirnagar University

Start Date:

End Date:

Program Area: Pest Management

Commodity: Insects

Objectives:

To identify this biological control agent based on mitochondrial cytochrome coxidase (COI) gene sequence.

Methodology:

The predatory efficacy of larval stages of Coccinella transversalis were tested on three agriculturally important aphid species i.e. Aphis craccivora, A. fabae and A. gossypii separately under controlled conditions (26 ± 2ºC and 65 ± 5% RH). To maintain a regular supply of the aphid and beetle population, a garden of bean, Lablab purpureus and brinjal plants, Solanum melongena were maintained at the Insect Rearing and Experimental Station, Department of Zoology, Jahangirnagar University. To investigate the predatory efficacy of larvae of the predator against aphids, newly hatched larvae of the predator were placed singly in six Petri dishes having a Whatman filter paper. A counted number of aphids (30) were provided in each Petri dish daily. Upper collar portion of the Petri dishes was treated with vaseline and covered with muslin cloth to avoid larval escape. Everyday, old leaves were substituted with new ones and unconsumed numbers of aphids were noted. The predation potential of larvae of the predator was investigated by feeding the grubs on aphids. The number of aphids consumed per day, during the period of study was recorded in each treatment by counting the number of remaining aphids and subtracting them from the total number of aphids provided. The larvae of the predator were also checked daily for their moulting to calculate the duration of each larval instar. This practice was continued until pupation. DNA isolation: Coccinella transversalis was collected from the stock culture of Molecular Entomology Laboratory of Jahangirnagar University. The genomic DNA was extracted from somatic tissue rich in mitochondria, e.g., leg or elytra (Levenbook and Williams 1956) using Wizard Genomic DNA Purification Kit, USA, following the manufacturer’s protocol with slight modification as mentioned in Aslam et al. 2019. The remaining parts of insects and respective individuals were kept as voucher specimens. Processed DNA was stored at 4⁰C or − 20⁰C. The quantity and purity of DNA was measured by using Nano drop 2000 spectrophotometer (Thermo Fisher Scientific, USA). 1 µl of nucleic acid was used to quantify nucleic acid. 260/280 Ratio, the ratio of absorbance was used to assess the purity of DNA. A ratio of ~1.8 was generally accepted as “pure” for DNA. The extracted DNA was subjected to PCR amplification through Applied Biosystems Veriti 96-Well Thermal Cycler following standard protocols. Primers used were forward primer: (LCO 1490 5′GGTCAACAAATCATAAAGATATTG G-3′) and reverse primer: (HCO 2198 5′TAAACTTCAGGGTGACCAAAAAATCA-3′). The PromegaGotaq G2 Green Master Mix (Promega Corporation) was used that contained GoTaq G2 DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient amplification of a wide range of DNA templates by PCR. The PCR reaction mixture consisted of total volume 20 µl among that master mix - 10 µl, forward primer - 1 µl (10 picomolar), reverse primer - 1 µl (10 picomolar), template DNA (50 mg), and adjustable nuclease free water. Thermocycling consisted of an initial denaturation of 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 49°C for 30 sec, extension at 72°C for 1 min, final extension: 72⁰C for 10 min and hold: 4⁰C. The chromatograms were converted to FASTA format using FinchTV chromatogram viewer software. The DNA sequences in ABI file were manually edited using BioEdit v.7.0.5. Results of sequence editing were analyzed using BLAST (Basic Local Alignment Search Tool) NCBI to indicate the homology from closest species. Phylogenetic tree was constructed using maximum likelihood method, calculation using Bootstrap with 1000 times of repetition in MEGA (Molecular Evolutionary Genetic Analysis) software program v.10.0. (Tamura et al. 2013). COI gene sequence of five coccinellid beetle (Coccinella transversalis) was also collected from National Centre for Biotechnology Information (NCBI) to compare with the research sample for their phylogenetic analysis.

Source of Information: Bangladesh J. Zool. 47(2): 229-241, 2019

Article Link (Online Journal): DOI: https://doi.org/10.3329/bjz.v47i2.44334

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

The potential role of C. transversalis in bio- control of three detrimental agricultural aphids. However, further field based studies are needed to confirm this hypothesis.

Knowledge Management: Journal