Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Antimicrobial Resistance of Escherichia Coli Isolated from Milk, Beef and Chicken Meat in Bangladesh

M. A. Rahman
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh. Present: Department of Medicine, Surgery and Obstetrics, Patuakhali Science and Technology University, Babugonj, Barisal, Bangladesh.

A. K. M. A. Rahman
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh.

M. A. Islam
Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh

M. M. Alam
Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh.

Abstract/ Executive Summary:

Food-borne pathogens causing infections and intoxications can affect everyone. Escherichia (E) coli is one of the major food borne bacterial pathogens. This study was conducted to investigate the prevalence of E. coli in milk, chicken meat and beef and to determine the multi-drug resistance profile of E. coli in Mymensingh district, Bangladesh. A total of 169 samples including milk (n=108), chicken meat (n=51) and beef (n=10) were collected from Bangladesh Agricultural University (BAU) dairy farm, American dairy farm, Gazipur and retail markets of municipal area during July 2016 to June 2017. E. coli were isolated and identified by colony characteristics on selective agar like Eosine-methylene blue (EMB) agar, Salmonella-Shigella (SS) agar, Gram staining, biochemical test and Polymerase Chain Reaction (PCR). The overall prevalence of E. coli in all food samples was 37.86%. A total of 32 (29.63%) milk, 25 (49.02%) chicken meat and 07 (70%) beef samples were E. coli positive through conventional method. Among 64 samples only 23 samples (35.94%) were confirmed by PCR. Multi-drug resistant E. coli were detected by disc diffusion test using 10 commonly used antibiotics. Antibiogram study showed that E. coli isolated from chicken meat were resistant to oxytetracycline (92%), sulphonamide-trimethoprim (84%), amoxycillin (76%) and erythromycin (60%). E. coli isolated from beef sample were resistant to erythromycin (85.71%) and oxytetracycline (71.43%) and sensitive to ciprofloxacin (100%), gentamicin (100%) and neomycin (100%). However, all isolates of E. coli were found sensitive to amikacin (100%). E. coli isolated from milk sample were 100% sensitive to gentamicin followed by neomycin, ciprofloxacin, azithromycin, oxytetracycline and erythromycin. Overall 50% of E. coli isolates of food were found multi-drug resistant. About 28.13%, 57.14% and 76% of the E. coli isolates originated from milk, beef and chicken meat respectively were multi-drug resistant. The higher prevalence of E. coli in chicken meat, beef and milk indicates unhygienic production and processing of these foods. Presence of multi-drug resistant E. coli in these foods might pose serious public health threats. The antibiogram profile of the isolates will help therapeutic decision making in the treatment of colibacillosis in cattle and poultry in Bangladesh.

Keywords: E. coli, Milk, Beef and chicken meat, Antibiogram, Multidrug resistance, PCR.

Location: Mymensingh and Gazipur district of Bangladesh.

Start Date: 00-07-2016

End Date: 00-06-2017

Program Area: Pest Management

Commodity: Meat, Milk

Objectives:

The objectives of this study were to isolate and identify antimicrobial resistant E. coli from chicken meat, beef and milk samples in Bangladesh.

Methodology:

Collection of samples: The samples were collected randomly from farms and local markets situated in Mymensingh and Gazipur district of Bangladesh. A total of 169 (51 poultry meat, 10 beef and 80 milk) samples have been tested from July 2016 to June 2017. Aseptically collected meat samples have been placed in sterile plastic bags and then brought to the Medicine laboratory of veterinary science at BAU using icebox. Milk samples have been collected from BAU dairy farm, American dairy farm, Gazipur, surrounding other local farm and market. Aseptically 8-10 ml of milk was collected in test tube directly from teat of lactating cow and local market and send to the Medicine laboratory using icebox. Five to ten grams of chicken breast meat or beef were collected aseptically in zipper bag and send to the laboratory using ice box. Sample preparation: Five to ten grams of meat were mixed with 10 ml of peptone (0.1%) water then homogenized suspension was prepared using sterilized pestle and mortar. Isolation and identification of E. coli: The homogenized samples were then transferred into nutrient broths (5 ml/test tube), nutrient agar and others specific media (EMB agar and SS agar, Hi-media, India). In every step, samples were incubated at 370C for 24 hours. The positive samples were then subculture several times to be pure culture. Gram staining and Biochemical test (five basic sugars) were done to be confirmed (Cheesbrough, 1985). Antibiotic disc diffusion (CLSI, 2012) test were done for E. coli in Muller- Hinton agar (Hi-Media, India). Polymerase chain reaction (PCR): DNA extractions were performed through boiling method (Hassan et al., 2012). PCR assay were applied in all the 64 isolates to confirm the E. coli. For the detection of E. coli a highly conserved region such as 16S rRNA was targeted. The nucleotide sequence (5’-3’) of the primer ECO-1Foward GACCTCGGTTTAGTTCACAGA and ECO1Reverse- CACACGCTGACGCTGACCA with amplicon size 585 bp (Fratamico et al., 2000) were used. PCR reaction mixture for single sample were 20 μl consisting of RNAse free water 5 μl, PCR master mixture (Thermo Scientific, EU) 10 μl, genomic DNA 3 μl and primer 2 μl. The PCR amplification was done by Initial denaturation at 940C for 3 minutes followed by 35 cycle of denaturation at 940 C for 45 second, annealing at 550C for 45 sec and extension at 720C for 60 secon. The final extension was at720C for7 min. PCR amplify products were subjected to gel (1% agarose, Takara, Japan) electrophoresis with ethidium bromide fluorescence (100 v for 30 minutes) and visualized in gel documentation system via UV transilluminator (302 nm). Detection of multi-drug resistant E. coli- Antimicrobial sensitivity test: Antimicrobial susceptibility of E. coli was performed by the disc diffusion test applied on Muller-Hinton agar (Hi-media, India) in vitro using 10 commercially available antibiotics (Oxoid, UK) e. g., oxytetracycline (30μg), ciprofloxacin (5μg), gentamicin (10μg), erythromycin, (15μg), azithromycin (15μg), sulphonamide-trimethoprim (25μg), neomycin (10μg), amoxicillin (10μg), doxycycline (10μg) and amikacin (30μg) according to the guidelines of the CLS1 (2012).

Source of Information: Bangl. J. Vet. Med. (2017). 15 (2): 141-146 ISSN: 1729-7893 (Print), 2308-0922 (Online)

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

CONCLUSIONS: The higher prevalence of E. coli in milk, chicken meat and beef indicates unhygienic production and processing of these foods. Presence of multi-drug resistant E. coli in these foods may pose serious public health threats. The antibiogram profile of the isolates may help therapeutic decision making in cattle and poultry practice in Bangladesh. Further studies on pathogenicity and detection of antibacterial resistant genes as well as genetic evolution can be performed.

Knowledge Management: Journal