Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Closterocerus Oryzamyntor (hymenoptera: Eulophidae: Entedoninae), a Larval Parasitoid of the Rice Hispa Dicladispa Armigera in Bangladesh (coleoptera: Chrysomelidae: Hispinae)

Alex Gumovsky
Schmalhausen Institute of Zoology, 15 Bogdan Khmelnitsky St., 01601 Kiev MSP, Ukraine. E-mail: gumovsky@izan.kiev.ua

Andrew Polaszek
Dept of Entomology, Natural History Museum, London SW7 5BD U.K. E-mail: a.polaszek@nhm.ac.uk

Sean T. Murphy
CABI Bioscience, Silwood Park, Ascot, Berks SL5 7PY, U.K. E-mail s.murphy@cabi.org

M.F. Rabbi
Bangladesh Rice Research Institute, Gazipur, Dhaka, Bangladesh

Chao-Dong Zhu
Institute of Zoology, Chinese Academy of Sciences, Beijing 100080, China. E-mail: zhucd@ioz.ac.cn

Abstract/ Executive Summary:

A new species of the genus Closterocerus (Hymenoptera: Eulophidae), Closterocerus oryzamyntor Gumovsky & Zhu sp. nov., is described based on morphological and molecular data. C. oryzamyntor is a larval endoparasitoid of a major pest of rice, Dicladispa armigera (Chrysomelidae: Hispinae). C. oryzamyntor is known so far only from Bangladesh, and only from this host. The species is characterized by the following morphological features: 1) deep sutures on the vertex of the male, connected to form a complete transvertexal suture in the female; 2) a comparatively long malar space, which is 0.3 times as long as the eye height, and 0.7 times as long as the breadth of the mouth; 3) predominantly pale femora, tibiae, tarsi and antennal scape; 4) the comparatively wide scape of the male, 2.6–2.7 times as long as broad; 5) the male pedicel, flagellum, coxae and gaster, which are all dark. Partial gene sequences of the 28S D2 ribosomal region were identical for all individuals sampled, but differed from two Closterocerus sequences on GenBank by 24 and 27 base pairs (about 6%). Both CytB and COI mitochondrial gene fragments demonstrated slight variation within the species, but no other eulophids have been sequenced for these genes, thus comparative data are lacking for these genes.

Keywords: 28S, Bangladesh, Biological control, Chrysomelidae, Closterocerus, COI, Cytochrome B, Dicladispa armigera, DNA, Eulophidae, gene sequences, hispa, parasitoid wasps, rice

Location: Bangladesh Rice Research Institute (BRRI), Gazipur, Bangladesh (BRRI)

Start Date:

End Date:

Program Area: Pest Management

Commodity: Insects

Objectives:

The purpose of this paper is therefore to describe a new species of Closterocerus of major economic importance for the biological and integrated control programmes for rice hispa in Southeast Asia, particularly Bangladesh. The following description is based on morphology, but DNA sequence data are also provided for the following genes: Nuclear ribosomal 28S D2, mitochondrial Cytochrome Oxidase I and Cytochrome B.

Methodology:

Rearing and preservation Specimens were collected by setting out rice plants infested with Dicladispa armigera larvae in the field at BRRI, Gazipur. This was done in June through to July, 2002. All ZOOTAXA specimens reared were preserved in 60% ethyl alcohol. Morphological study Morphology was examined using both light and scanning electron microscopy. The latter was undertaken in the Mineralogy Department of the Natural History Museum (London) using an LEO 14S5VP microscope, which allows imaging of uncoated specimens (under the program LEO-32 V04.00.01). General morphology images were taken with a JVC 3-CCD colour video camera KY-F55B with Auto-Montage Pro software (Synoptics U.K. Ltd.). Terms used in the description of the new species generally follow Hansson (1990), in order to facilitate comparison with previously described species. However, some terminology has been adjusted following Gibson et al. (1997). DNA sequencing Genomic DNA was extracted from each individual using a protocol largely based on those described in the DNeasy® Tissue Handbook provided by QIAGEN (www.qiagen.com) and Wizard® SV96 genomic DNA Purification System (www.promega.com). The following pairs of primers were used to amplify three gene fragments: 28S D1 & D2: D1F (ACCCGCTGAATTTAAGCATAT) (Harry et al., 1996) and D2R (TTGGTCCGTGTTTCAAGACGG) (Campbell et al., 2000); COI Jerry & 2613: COI-Jerry (CAACATTTATTTTGATTTTTTGG) and COI-2613 (ATTGCAAATACTGCACCTAT) (Simon et al., 1994); CytB 3 & 4: CB3 (GAGGAGCAACTGTAATTACTAA) and CB4 (AAAAGAAA(AG)TATCATTCAGGTTGAAT) (Barraclough et al. 1999). Standard Polymerase Chain Reactions (PCR) were carried out in 25µl reactions consisting of 2.5µl BIOTAQ 4x NH4 Buffer, 2.625µl 25 mM MgCl2, 0.7µl dNTP, 0.35µl forward and reverse primers, 0.084µl BIOTAQ Taq polymerase and 1–4µl DNA. Various volumes of distilled water were added to make the total volume up to 25 µl for each reaction. Gene fragments were sequenced in both directions.

Source of Information: Zootaxa 1241: 51–59 (2006) ISSN 1175-5326 (print edition) ISSN 1175-5334 (online edition)

Article Link (Online Journal): www.mapress.com/zootaxa/

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

Preliminary observations have been made on the field biology of Closterocerus oryzamyntor by staff at the Bangladesh Rice Research Institute (BRRI), Gazipur, Bangladesh (BRRI), unpublished report). These observations were reported as being on ‘Neochrysocharis sp.’. C. oryzamyntor appears to be the most common larval parasitoid of D.armigera in Bangladesh. Studies on field parasitism using ‘trap plants’ (using 2nd and 3rd instar D. armigera larvae) indicate that parasitism is low during the December – January period (when the boro rice is being grown), but generally rises in August and September, when the aus rice crop is in the ground. Estimates of parasitism during months and between years is highly variable, but values of over 80% have been recorded. BRRI have also made observations on the life history of the parasitoid by exposing insectary-reared D.armigera to mated female parasitoids, previously reared from naturally parasitized D. armigera. This work has suggested that C. oryzamyntor lays more eggs, proportionally, in 2nd and 3rd instar larvae compared with other instars. The mean longevity of adults fed on a 50% honey solution was 4.3 days; minimum and maximum survival was 3 and 6 days respectively. Also, at about 30⁰ C and 80% RH, the development time, from egg to adult, varied between 8 and 13 days, with a mean of 10.7 days.

Knowledge Management: Journal