Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Phylogenetic Position of the Western Bangladesh Populations of Weaver Ant, Oecophylla Smaragdina (fabricius)(hymenoptera: Formicidae)

MM Rahman
Institute of Tropical Agriculture, Kyushu University, Fukuoka, Japan

S Hosoishi
Institute of Tropical Agriculture, Kyushu University, Fukuoka, Japan

K Ogata
Institute of Tropical Agriculture, Kyushu University, Fukuoka, Japan

Abstract/ Executive Summary:

The weaver ant species, Oecophylla smaragdina is distributed from India through Southeast Asia to Northern Australia including many tropical Western Pacific Islands. A recent phylogenetic study of O.smaragdina revealed the central Bangladesh population as belonging to the Southeast Asian mainland clad despite of its geographical proximity to India. However, the Bangladeshi analyzed sample was limited to a single site and the geographical border between Indian and Southeast Asian groups has not been presented. In this study, 19 samples collected from western parts of Bangladesh have been used to infer the phylogenetic position. A total of 20 O.smaragdina colonies were sampled from Bangladesh during 2013 to 2014. Their haplotype and phylogenetic relationships were determined by analyzing 2 mitochondrial loci: Cytochrome b (Cytb) consisting of 606 bp and Cytochrome c oxidase subunit I (COI) consisting of 775 bp. Bayesian analysis inferred that the western parts of Bangladesh were occupied by mitochondrial haplotype usually found in India, which is recorded first time in the country. The present study revealed that, both the Indian and Southeast Asian mitochondrial haplotypes were occurred on either side of Ganges river.

Keywords: Mitochondrial DNA, Cytb, Geographical distribution, COI, Ganges River.

Location: 4 divisions of Bangladesh

Start Date: 00-00-2013

End Date: 00-00-2014

Program Area: Pest Management

Commodity: Ant

Objectives:

The goal of the present study is to test whether the western Bangladesh populations of O. smaragdina all belong to the SE Asian clade.

Methodology:

Sampling and preparation of specimens In 2013 to 2014 we collected adult Oecophylla smaragdina workers from 20 colonies at 19 localities in 12 districts belonging to 4 divisions of Bangladesh. The specimens were preserved in 99% ethanol prior to DNA extraction.Molecular studiesGenomic DNA was extracted from the fore, middle and hind legs of specimens that were preserved in alcohol by using QIAGEN DNeasy Blood and Tissue kit (Qiagen, Meryland, USA). Amplification of mitochondrial DNA was done by polymerase chain reaction (PCR). The thermal cycling parameters for Cytb and COI basically followed the protocols established by Crozier and Crozier (1993) and Sameshima et al. (1999), including 95 °C for 5 min for initial denaturation, 35 cycles of dissociation (92 °C, 1 min), annealing (50 °C for Cytb and 54 °C for COI, 1 min), and extension (70 °C, 2 min). The primers used for amplification are identical to primers reported by Crozier et al. (1994), Lunt et al. (1996), Azuma et al. (2002), and Azuma et al. (2006). Primers for the Cytb gene fragment were Cb1 (5‘TATGTACTACCATGAGGACAAATATC’3) and tRs (5’TATTTCTTTATTATGTTTTCAAAAC’3). For the COI gene fragment, COI 1-3 (5’ATAATTTTTTTTATAGTTATACC’3) and COI 2-4 (5’TCCTAAAAAATGTTGAGGAAA’3) were used as forward and reverse primers, respectively (Crozier & Crozier, 1993). Illustra and ExoProStar were followed according to the instruction of the manufacturer GE Healthcare. For cycle sequencing, ABI PRISM Big Dye Terminator v3.1 cycle sequencing kits from Applied Biosystems were used in an automated sequencer. Primers for the sequencing reaction were identical to those used in the amplification step. Sequencing reaction was performed by using ABI 3100 Avant DNA Sequencer (Applied Biosystems). For the phylogenetic analysis of western Bangladeshi O. smaragdina populations, 16 samples for Cytb and 19 samples for COI genes have been used with 606 bp and 775 bp, respectively. In addition, in this analysis, sequence data of both COI and Cytb were used from Azuma et al. (2002), Azuma et al. (2006) and Asaka (2010) retrieved from DDBJ GenBank. Sequence data of both COI and Cytb of Oeocophylla longinoda from Cameroon were used as outgroup in this analysis. The sequencing analysis was done by using Vector NTI Advance ver. 11.5 software. Haplotypes of Cytband COI were aligned by using MEGA 6.0 software (Tamura et al., 2013). Phylogenetic trees inferred from concatenated matrix conducted by Bayesian methods based on MrBayes 3.1.2. For the selection of best- fit model MrModeltest 2.3 was performed with PAUP*4.0 Beta version10. For both mitochondrial COI and Cytb genes, substitution model GTR + I + G with 1,000,000 generations were used. The nucleotide sequences for both Cytb and COI have been deposited in the GenBank with accession number mentioned in Table 1.

Source of Information: Sociobiology 64 (4): 437-441 (December, 2017)

Article Link (Online Journal): DOI: 10.13102/sociobiology.v64i4.1153

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

We here confirm that O. smaragdina populations with Indian mitochondrial haplotypes exist in the western part of Bangladesh. The result of present study suggested the importance of comprehensive surveys, also taking into account the central and eastern populations of Bangladeshi O. smaragdina.

Knowledge Management: Journal