Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Molecular Diversity of Freshwater Fishes of Bangladesh Assessed by DNA BARCoding

Md Sagir Ahmed
Department of Zoology, University of Dhaka, Dhaka1000, Bangladesh

Sujan Kumar Datta
Department of Zoology, Jagannath University, Dhaka1100, Bangladesh

Ayesha Akhter Zhilik
Department of Zoology, University of Dhaka, Dhaka1000, Bangladesh

Abstract/ Executive Summary:

This study represents the comprehensive molecular identification of freshwater fishes of Bangladesh based on a fragment of the cytochrome c oxidase subunit I (COI) gene in the mitochondrial genome. A total of 315 mitochondrial COI barcode sequences were obtained from 153 species,114 genera, 49 families and 16 orders of fishes. The mean length of the sequences was 652 base pairs. For all the samples, %G was significantly lower compared to the other nucleotides and %GC was lower compared to % AT (p-value ? 0.05). Also, a significantly lower %GC content was observed in second and third codon position compared to the first one in all the samples (1^st>2^nd>3^rd, p-value? 0.05). The average K2P distances within species, genera, families and orders were 0.38%, 7.02%, 12.75% and 18.68%, respectively. The mean interspecific distance was 18-fold higher than the mean intraspecific distance. The K2P neighbor-joining (NJ) trees based on the sequences generally clustered species according to their taxonomic position. A total of 12 species were newly recorded in Bangladesh. High efficiency in species identification were demonstrated in the present study by DNA barcoding, and concluded that COI sequencing can be used as an authentic identification marker for freshwater fish species.

Keywords: Freshwater fishes, COI, DNA Barcoding, Genetic Diversity, Phylogeny

Location: Haor, baor, beels, floodplain, fish landing centers, fish markets

Start Date: 00-07-2014

End Date: 00-06-2018

Program Area: Variety and Species

Commodity: Fish

Objectives:

To the molecular characterization of morphologically identified freshwater species of Bangladesh using partial COI gene sequence.

Methodology:

Study area and specimen collection: Fish samples were collected from rivers, haor, baor, beels, floodplain, fish landing centers, fish markets or from the local fishermen during July 2014 to June 2018. Personal fishing was also conducted to collect some rare and non-commercial fish species whenever necessary. Photographs of all the fishes were taken immediately and taxonomic identification of specimens were done following previous reports (Talwar and Jhingran 1991, Rahman 2005, Siddiqui et al. 2007). Immediately after collecting the specimens, tissue samples were excised and stored in 90% ethanol. Voucher specimens were fixed with 10% formalin and then transferred to 70% ethanol solution for preservation. Voucher specimens were transported to Dhaka and deposited in the Professor Kazi Zaker Hussain Museum at the Department of Zoology, University of Dhaka. DNA barcoding: Genomic DNA was extracted from the muscle tissue samples by the standard Proteinase-K/Phenol-Chloroform-isoamyl alcohol method (Green and Sambrook 2012, Ahmed et al. 2019). The quality and quantity of the extracted DNA was measured using Nanodrop™ spectrophotometer. Approximately 658bp was amplified from the 5′ region of the MT-COI gene using the following primers: FishF1 5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1 5′ TAGACTTCTGGGTGGCCAAAGAATCA3′ only when failed to amplified the FishF2 5′TCGACTAATCATAAAGATATCGGCAC3′ and FishR2 5′ACTTCAGGGTGACCGAAGAATCAGAA3′ were used (Ward et al. 2005). For this, 25 µl PCR reaction mixtures were prepared which included 17.25–18.75 µl of ultrapure water, 2.5 µl of 10× PCR buffer, 1.25 µl of MgCl2 (50 mM), 0.25 µl of each primer (0.01 mM), 0.125 µl of each dNTP (0.05 mM), 1 µl (0.625 U) of Taq polymerase, and 0.5–2.0 µl of DNA template. Amplifications were performed using ABI thermal cycler (Thermo Fisher Scientific). The thermal regime consists of an initial step of 2 min at 95°C followed by 35 cycles of 0.5 min at 94°C, 0.5 min at 54°C, and 1 min at 72°C, followed in turn by 10 min at 72°C and then held at 4°C. PCR products were visualized on 1% agarose gel. The PCR products were purified using PureLink™ PCR purification kit and sequenced from First BASE Laboratories, Sdn Bhd, Malaysia. All sequences were translated into amino acids to confirm the effectiveness of the sequences and to detect the presence of nuclear DNA pseudo genes, insertions, deletions, or stop codons. Sequences were checked and aligned using Sequencer v5.4.6 and were submitted to GenBank with referred accession numbers. All the data including taxonomic characteristics and GenBank accession numbers were tagged with the voucher specimens preserved at the Professor Kazi Zaker Husain Museum of Department of Zoology, University of Dhaka. Bioinformatic and statistical analyses: Bioinformatic analyses of the sequences were performed using CLC Workbench v7.7.1, Mega X, Clustal Omega, and T-Coffee. Base compositions were analyzed using CLC Workbench v7.7.1 and Mega X. Genetic distance and sequence divergences were calculated using the Kimura two parameter (K2P) distance model (Kimura 1980). Neighbor-joining (NJ) trees of K2P distances were created to provide a graphic representation of divergence pattern between species (Saitou and Nei 1987). Bootstrapping was performed in MEGA X (Tamura and Nei 1993) with 1000 replications (Felsenstein 1985). Necessary statistical analyses were performed in Excel 2013 and RStudio.

Source of Information: Bangladesh J. Zool. 48(1): 1-19, 2020

Article Link (Online Journal): DOI: https://doi.org/10.3329/bjz.v48i1.47872

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

The present study revealed that DNA barcoding has been successful in identifying the freshwater fishes of Bangladesh. We have barcoded 153 species of freshwater fishes and these barcode data confirms the 12 new records from Bangladesh. When traditional morpho taxonomy does not work, this molecular tool is effective for species identification, particularly with specimens that are damaged, incomplete, or morphologically distinct stages. Nevertheless, DNA barcoding also has its limitations too. Therefore, DNA barcoding can serve as a complementary tool for species identification, but it cannot replace the traditional morpho-taxonomy. Through this study, a reliable DNA barcode reference library for Bangladeshi freshwater fish was established, which could be used to assign fish species by screening sequences against it in the future. This could enhance to achieve better monitoring, conservation, and management of fisheries in this overexploited country.

Knowledge Management: Journal