Survey has been conducted at farmers’ fields of two different watermelon growing areas (Godagari; Rajshahi & Gorudaspur, Nator) and HRC, experimental field BARI, headquarter in 2018-19 cropping season. The disease incidence of different types of diseases has been recorded and symptomatic samples were brought to the PPD, BARI, for further studies.
- Identification of viral diseases of watermelon.
- Direct antigen-coated enzyme-linked immunosorbent assay (DAC-EISA)
Direct antigen-coated enzyme-linked immunosorbent assay (DAC-ELISA) (Clark and Bar-Joseph, 1984) was performed to detect the association of an orthotospovirus with the BND diseased in watermelon samples. The assay was performed in 96 well polystyrene microtitre plates (Costar, Sigma, USA). Briefly, 96 well plates were coated with diseased leaf extracts diluted 1:4 (w/v) in coating buffer contained 15mM sodium carbonate, 35mM sodium bicarbonate, 2% polyvinylpyrrolidone (PVP- 40) with pH 9.6 and incubated at 37 °C for 1 h. After three subsequent washing with PBS-T buffer contained 136mM NaCl, 1.4mM KH2PO4, 2.6mM KCl, 8mM Na2HPO4, 0.05% Tween-20, with adjusted pH 7.4, these plates were further blocked with 2% bovine serum albumin (BSA) for 1 h at 37 °C. After three repeated washing with PBS-T, specific antiserum against the nucleocapsid (N) protein of groundnut bud necrosis orthotospovirus (GBNV) generated at ACPV, IARI, New Delhi was diluted (1:1000) with PBS-TPO contained PBS-T with 2% PVP-40 and 0.2% ovalbumin was loaded to the wells of ELISA plate and incubated at 37 °C for 1 h followed by three washing with PBS-T. Goat anti-rabbit IgG-AP conjugate (Sigma-Aldrich, St. Louis, USA at a dilution of 1:30,000 in PBS-TPO) was added and incubated at 37 °C for 1 h. Finally, the plates were washed thrice with PBS-T and para-nitrophenyl phosphate (pNPP) substrate (at 0.5 mg/ml pNPP dissolved in 9.7% diethanolamine buffer, pH 9.6) was added. The OD values @ 405 nm were measured by ELISA reader (TECAN A-5082, Sun Rise, Austria) after 1 h of substrate incubation at 37 °C. Watermelon samples showing absorbance (O.D. at 405) values more than two times than that of healthy control were considered as infected with the orthotospovirus.
- Reverse-transcription polymerase chain reaction (RT-PCR
The ELISA positive watermelon samples were further subjected for the specific detection of WBNV virus isolate by duplex reverse transcription-polymerase chain reaction (RT-PCR) using species-specific forward primers (for GBNV: Gs1F: 5′-ATGGTTGAAAAGAGCAAGAATG. ATGC-3′ and for WBNV: Ws1F: 5′-CAAAGACTTGTTGGCTGGTGG TG- 3′) and a common degenerate reverse primer (for both GBNV and WBNV GWs1R: 5′-CTTCTT (A/T) GA (A/G) TGT (AC/T) CACCATA (A/ G) TCATCC-3′) designed using N gene sequences of both the viruses and were used as described by Akhter et al. (2012). Total RNA was extracted from the infected and healthy (control) watermelon samples (∼100 mg) using RNeasy plant mini kit (Promepa, USA) according to the manufacturer's instruction. Extracted RNA was used as a template for RT-PCR along with the positive control. The first-strand cDNA was synthesized using ImProm-II™ reverse transcriptase kit (Promega, USA). The 20 μl cDNA reaction mixture contained 8 μl template RNA (∼2.5 μg), 1 μl (100 pg) reverse primer, 2 μl 25mM MgCl2, 1 μl 10mM dNTP, 4 μl 5× buffer, 0.5 μl RNase inhibitor (40 Uμl−1) (Promega, USA) and 2.5 μl sterile distilled water and 1 μl reverse transcriptase (200 Uμl−1) was incubated at 42 °C for 60 min. The 25 μl PCR reaction mixture comprised 5 μl template cDNA, 5 μl 5 X PCR buffer, 3.5 μl 25mM MgCl2, 2.5 μl 10mM dNTP, 3.0 μl (∼100 pg) each of reverse and two forward primers, 1.0 μl of Taq DNA polymerase and sterile distilled water up to 25 μl. The PCR was conducted in a thermal cycler (Biometra, Germany) with the following temperature conditions: 2 min hot start at 94 °C followed by 30 cycles of denaturation at 94 °C for 30 s, annealing for 1 min at 52 °C and synthesis at 72 °C for 1 min, and a cycle of final extension at 72 °C for 10 min. The PCR product was analysed in 1% agarose gel in Tris-acetate EDTA containing ethidium bromide (Sambrook and Russell, 2001).
- Identification of fungal diseases
- Isolation and Morphological characterization of the associated fungi
Infected plant parts of watermelon were collected and brought to the Plant Pathology Laboratory of Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh for identification and characterization of the fungi. Pieces of the diseased tissues of watermelon were sterilized by 10% chlorox for 2-3 minutes, followed by several rinses with sterile distilled water and placed on potato dextrose agar (PDA). After a day single spore was collected using a sterilized glass needle under a dissecting microscope and transferred to Petri plates containing PDA media and incubate at 25±5oC for up to 12 days. After incubation, the appearance of the colonies, and the vegetative and reproductive structures of fungus were examined under stereo as well as a compound microscope.
- Pathogenecity test of the isolated fungi
Pathogenicity test was conducted on symptomless detached leaf of watermelon with slight modification (Akhter et al. 2009). The mycelial plug (6mm) of one isolate (AL2) was placed on the watermelon leaf which was previously wounded by sterile needle and kept the inoculated leaf on the porcelain plate of the dedicator. Total 3 leaf was inoculated by the AL2 isolate and 1 leaf were mock inoculated by the PDA plug (6mm) without fungi. After inoculation, the dedicators were incubated at 25°C with 90% relative humidity in 12h light/12h dark conditions.
- Molecular identification of the associated fungi using sequencing
Total genomic DNA of pathogenic fungi was extracted from 12 days old mycelium using a commercial DNA extraction kit (Promega, USA) according to protocol supplied by the manufacturer and PCR was done using Thermocycler (Nyx Technik, USA). The universal primers for PCR were obtained from Invent Technology, Bangladesh. The primer pairs ITS1, 5’CGGATCTCTTGGTTCTGGCA3’ and ITS4, 5’GACGCTCGAACAGGCATGCC3’were used for rDNA amplification (White 1990). The PCR amplification was carried out in 25µl reaction mixture containing 1ng of DNA added to 5µl of 5× PCR buffer, 2.0µl of 25mM MgCl2, 2.0µl of 2mM dNTPs (Promega, USA), 20pmol of each forward and reverse primer (1.0µl) and 0.2µl of Taq DNA Polymerase and made up to 25µl with nuclease free water. The PCR conditions include initial denaturation at 94ºC for 3min, 30 cycles of denaturation at 94ºC for 30s, annealing at 48ºC for 30s, followed by extension for 30s at 72ºC and a final extension at 72ºC for 10min. After amplification, the size and concentration of PCR products were verified by 1.5 % agarose gel in Tris-borate-EDTA (TBE) buffer