Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Survey and Management of Wilt Disease of Guava

MD. IQBAL FARUK
PSO
Plant Pathology Division, BARI, Gazipur

Abstract/ Executive Summary:

A survey was conducted to assess the guava wilt and the identification of causal pathogen in the northern and southern parts of Bangladesh the major guava-producing region. Among the surveyed locations the highest disease incidence up to 100 percent was observed in Charghat upazilla of Rajshahi district in old orchards but the disease incidence is low in the newly established orchard i.e 3-5 years old. The wilt disease incidence is low in the Southern part of Bangladesh as compared to the Northern part The isolated causal pathogen is Fusarium sp and fulfills the pathogenicity.

Keywords: Guava, Disease, Survey

Location: Charge at and Godagari and Fruit Research station at Rajshahi district and two Upazila namely Uzirpur and Swarupkati of Barisal

Start Date:

End Date:

Program Area: Pest Management

Commodity: Diseases, Guava

Objectives:

The present investigation has been taken to know the present status of guava wilt in Bangladesh and to develop appropriate management package of this disease

Methodology:

The following strategies have been performed to assess the guava wilt disease incidence and identification of the causal pathogen.

Step 1: Survey of guava wilt disease in the major guava growing areas in Bangladesh

We have surveyed two upazila namely Charghat and Godagari and Fruit Research station at Rajshahi district and two upazila namely Uzirpur and Swarupkati of Barisal districts the major guava producing region in Bangladesh. Five guava orchards of each location have been surveyed and noted the percent disease and representing disease samples along with the soil brought to Plant Pathology Laboratory for isolation and identification of the causal pathogen. Pieces of the diseased tissues of guava were sterilized by 10% chlorox for 2-3 minutes, followed by several rinses with sterile distilled water and placed on Potato dextrose agar (PDA). After a day single spore was collected using sterilized glass needle under a dissecting microscope and transferred to Petri plates containing PDA media and incubate at 25±5^oC for up to 12 days. After incubation, the appearance of the colonies and the vegetative and reproductive structures of fungus were examined under stereo as well as a compound microscope.

Step 2. Pathogenicity test of the isolated fungi

A pathogenicity test was conducted on a symptomless one month old guava seedling. The isolated fungi (CGW1; CGW2 & GGW1) were grown in the wheat brain and incorporated into the sterilized soil placed on an earthen pot and covered by black polythene for one week. The months-old guava seedling variety BARI- Peyara 2 was transplanted to the pots with three replications. The pot poured by only sterilized soil is served as control.

Step 3. Molecular identification of the associated fungi using sequencing

Total genomic DNA of pathogenic fungi was extracted from 12 days old mycelium using a commercial DNA extraction kit (Promega, USA) according to the protocol supplied by the manufacturer and PCR was done using Thermocycler (Nyx Technik, USA). The universal primers for PCR were obtained from Invent Technology, Bangladesh. The primer pairs ITS1, 5’CGGATCTCTTGGTTCTGGCA3’ and ITS4, 5’GACGCTCGAACAGGCATGCC3’were used for rDNA amplification (White 1990). The PCR amplification was carried out in a 25µl reaction mixture containing 1ng of DNA added to 5µl of 5× PCR buffer, 2.0µl of 25mM MgCl2, 2.0µl of 2mM dNTPs (Promega, USA), 20pmol of each forward and reverse primer (1.0µl) and 0.2µl of Taq DNA Polymerase and made up to 25µl with nuclease-free water. The PCR conditions include initial denaturation at 94ºC for 3min, 30 cycles of denaturation at 94ºC for the 30s, annealing at 48ºC for 30s, followed by extension for 30s at 72ºC and a final extension at 72ºC for 10min. After amplification, the size and concentration of PCR products were verified by 1.5 % agarose gel in Tris-borate-EDTA (TBE) buffer.

Source of Information: Annual Research Report 2018-19, Plant Pathology Division, BARI, Gazipur

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

On the basis of the present study, it was concluded that the guava wilt caused by Fusarium sp is the devastating disease of guava in the Southern and Northern parts of Bangladesh. The identification of causal pathogen up to the race and associated another causal pathogen if any are now in progress.

Knowledge Management: Report/Proceedings