Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Collection, Isolation, Molecular Characterization and Determination of Genetic Diversity of Sclerotinia Sclerotiorum Isolates from Different Sources in Bangladesh (2017 - 2018)

M.M.E. Rahman
Plant Pathology Division, BARI, Gazipur

Abstract/ Executive Summary:

An experiment was conducted at Molecular Plant Pathology Laboratory of Plant Pathology Division, BARI with fourteen isolates of Sclerotinia sclerotiorum for its molecular characterization and determination of genetic variation among the isolates collected from different hosts and locations. All the DNA samples of the isolates were amplified properly and those were clearly verified by agarose gel electrophoresis. Amplified DNA was sent for sequencing. In the case of a genetic variation study, during the rep-PCR using ERIC21 primer, it was clear that there was a distinct variation among the isolates.

Keywords: Sclerotinia sclerotiorum, Molecular characterization, Determination of genetic variation

Location: A total of fourteen isolates of S. sclerotiorum were excised from infected samples collected from different districts namely Rangpur, Lalmonirhat and Bogra

Start Date:

End Date:

Program Area: Pest Management

Commodity: Pest

Objectives:

The study has been done to find out the molecular characteristics of S. sclerotiorum.

Methodology:

Sample collection: A total of fourteen isolates of S. sclerotiorum were excised from infected samples collected from different districts namely Rangpur, Lalmonirhat and Bogra. Fungi were grown on PDA and preparation of pure cultures was done through a single mycelium isolation technique. DNA Extraction: Total DNA from fourteen isolates was extracted from the isolates separately by using a commercial DNA isolation kit (Promega, USA) with little modifications. PCR amplification of ITS region and sequencing: A part of ITS region was amplified in a 25 μl reaction mixture with primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) using a ready master mix kit (Promega, USA) following manufacturer’s instructions. The reaction mixtures were incubated in a Dynyx PCR Thermal Cycler (ATC401, Nyx Technik, USA) following programs: initial denaturation at 94°C for 2 min, followed by 30 cycles of denaturation of 98°C for 10 s, annealing at 57°C for the 30s, polymerization at 68°C for 1 min, and final elongation at 68°C for 7 min. Five microliters of each amplification mixture were verified by agarose (1% w/v) gel electrophoresis in 0.5X Tris-borate-EDTA (TBE) buffer. Molecular characterization of the fourteen isolates will be determined by the partial sequencing of ITS region (White et al. 1990) followed by phylogenetic analysis. Therefore, samples of amplified DNA will be sequenced by a company (Malaysia). After sequencing of ITS amplicons, homology will be evaluated with NCBI BLAST tool for comparison and identification of the isolates. Phylogenetic analysis for nucleotide sequences of fungal isolates will be carried out with MEGA 6 program. Genetic variability: For determination of genetic variability rep-PCR using ERIC21 primer was conducted. The reaction mixtures were incubated similarly in a PCR Thermal Cycler (ATC401, Nyx Technik, USA) following programs: initial denaturation at 94°C for 2 min, followed by 30 cycles of denaturation of 98°C for 10 s, annealing at 50°C for the 30s, polymerization at 68°C for 1 min, and final elongation at 68°C for 7 min. Five microliters of each amplification mixture were verified by agarose (1% w/v) gel electrophoresis in 0.5X Tris-borate-EDTA (TBE) buffer.

Source of Information: Annual Research Report 2016-17, Plant Pathology Division, BARI, Gazipur

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

A total of fourteen isolates of Sclerotinia sclerotiorum were collected from different hosts and different locations. After DNA extraction, during PCR all the DNA samples of the isolates were amplified properly and those were clearly verified by agarose gel electrophoresis (Fig 1). Amplified DNA was already sent for sequencing. In the case of genetic diversity study with the rep-PCR using ERIC21 primer, it was clear that there was a distinct variation among the isolates in terms of hosts and locations. The internal transcribed spacer (ITS) region was considered as a universal DNA barcode marker for the fungi worldwide (White et al. 1990). There was not much information about the molecular characterization of various fungal isolates along with the genetic diversity of the fungus in the country till now except few reports. The current study of molecular characterization of S. sclerotiorum may add some additional information for the pathogens

Knowledge Management: Report/Proceedings