A pot experiment was carried out at net house, Soil Science Division, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur (24.00o N latitude, 90.25o E longitude and 8.4 m elevation) on 05 January 2017 during rabi season. The pot soil belongs to the Chhiata series of Grey Terrace Soil. The experiment was laid out in Complete Randomized Design (RCD) with four replications. There were six treatments viz. T1: BARI RGm 901, T2: BARI RGm 902, T3: BARI RGm 903, T4: BARI RGm 904, T5: BARI RGm 905, T6: Control which were replicated into four. The tested crop was soybean (cv. BARI Soybean-6). Peat based rhizobial inoculum containing 108 cells g-1 inoculum was used at the rate of 1.5 kg ha-1. Soybean seeds were mixed thoroughly with the inoculum before sowing. Seeds were used at the rate of 75 kg ha-1. Phosphorus, potassium, sulphur, zinc and boron (P42K40S40Zn5B1 kg ha-1) were used in the form of TSP, MoP, gypsum, zinc sulphate and boric acid, respectively. All P, K, S, Zn, B were applied at the time of pot preparation. All the intercultural operations such as irrigation, weeding, insect control etc. were done as and when necessary. Nodules were collected by carefully uprooting five sample plants selected randomly from each unit plot at the 50 percent flowering stage. Nodules were separated from the roots, counted and then oven-dried and weighed. Data on yield and yield components were recorded at maturity. The crop was harvested on 02 May 2017. The initial soil samples at a depth of 0-15 cm from the experimental fields were collected and analyzed following standard methods.
Bacteria isolation and PCR amplifications of 16S rDNA:
Rhizobium strains were isolated from soybean plants nodules. Nodules were collected aseptically and crushed in 100 μl of sterile distilled water using a homogenizer. A loop full of suspension was streaked onto yeast extract mannitol (YEM) agar plates and incubated at 30 °C for 2 to 3 days. A single colony was isolated and purified by repeated streaking on YEM agar plates. These colonies were preserved on agar slants at 4 °C until further use. Isolated bacteria were cultured in test tubes (Pyrex®, USA) containing 3 ml in YEM liquid broth by shaking in a rotary shaker (KSI-100L Shaking Incubator, Koencon, Hanam, Korea) at 180 rpm, 30°C, for 48 hours, and the cultures were centrifuged at 18,000 g for 5 minutes at 4°C. Genomic DNA was extracted from the pellet using the FastDNA SPIN Kit (MP Biomedicals, Santa Ana, CA, USA), and DNA yield was quantified using a spectrophotometer (NanoDrop 2000C, Thermo Scientific, Waltham, MA, USA). The extracted bacterial DNA was used as a template for PCR amplification of 16S rDNA. Bacterial 16S rDNA was amplified by PCR with the forward primer 27F (5´- AGAGTTTGATCCTGGCTCAG -3´) and reverse primer 1492R (5´- GGTTACCTTGTTACGACTT -3´). About 50 ng of template DNA was used in each reaction. The PCR conditions and primer sequences used for sequencing. PCR products were gel purified using the QIAEX®II Gel Extraction Kit (Qiagen GmbH, Hilden, Germany).
Sequencing and phylogenetic analysis:
DNA sequencing was performed using an Applied Biosystems 3730 automated sequencer with the M13 primer to obtain nearly full-length bacterial 16S rDNA sequences. The bidirectional gene sequences were compiled using DNAMAN software (DNAMAN version 4.11, Lynnon Biosoft, San, Ramon, CA, USA), and the sequences were analyzed using MEGA 5.2 software. The consensus sequence was used in a BLAST search of the NCBI GenBank database. Phylogenetic analysis was conducted using MEGA version 5.2, and a neighbor-joining tree was constructed using Kimura 2-parameter distances with 1000 replicates to estimate bootstrap support. The compiled sequence of the Rhizobium sp. strains will be deposited in the GenBank database and assigned accession number.
Methods of chemical analysis:
Soil pH was measured by a combined glass calomel electrode (Jackson, 1958). Organic carbon was determined by wet oxidation method (Walkley and Black). Total N was determined by modified Kjeldahl method. Calcium, K and Mg were determined by NH4OAc extraction method. Copper, Fe, Mn and Zn were determined by DTPA extraction followed by AAS reading. Boron was determined by CaCl2 extraction method. Phosphorus was determined by Bray and Kurtz method (Acid soils) and Modified Olsen method (Neutral + Calcareous soils). Sulphur was determined by CaH4(PO4)2.H2O extraction followed by turbidimetric turbidity method with BaCl2.