The seeds of Indica rice (O. sativa L.) cultivar namely BRRI dhan 58 was collected from Bangladesh Rice Research Institute (BRRI), Gazipur, Bangladesh and used in this study for in vitro regeneration and genetic transformation. Mature seeds of BRRI dhan 58 were dehusked carefully and taken in a beaker containing distilled water. After that, Twin-80 (1 or 2 drops) was added and the mixture was shacked for 5 min in a shaker. Seeds were then washed several times with distilled water to remove the influence of Twin-80. The seeds were again surface-sterilized twice with 0.1% (w/v) HgCl2 solution for 5 min by vigorous shaking flowed by rinsed with sterile distilled water several times to remove traces of mercuric chloride completely. Treated seeds were then dried onto a filter paper. The sterilized mature seeds of indica rice cultivar BRRI dhan 58 were incubated in callus induction medium [MS salts and vitamins, proline 65 mg/l, casein hydrolysate 30 mg/l, 2,4-D 2.5 mg/l, BAP 0.15 mg/l, sucrose 30 g/l, phytagel 4 g/l, agarose 2 g/l, pH 5.8] at 26 ± 2°C for 21 days in dark condition. The mature seed-derived callus was then sub-cultured in the same callus induction medium at 26 ± 2°C for 7 days and used for Agrobacterium mediated genetic transformation. A. tumefaciens strain LBA4404 and pCAMBIA1301 were used for genetic transformation. The T-DNA region of the plasmid pCAMBIA1301 carries GUS gene and hygromycin-resistance (hptII) gene; both are under the control of CaMV35S promoter. A single PCR positive Agrobacterium colony was taken in a 5 ml liquid culture of YEM medium and incubated at 28°C overnight in a rotary shaker. One ml of primary culture was inoculated in 100 ml of YEM liquid medium containing Streptomycin 25 mg/l, Rifampicin 10 mg/l and Kanamycin 50 mg/l and again incubated in a rotary shaker at 28°C for over-night. When the optical density (OD600) of Agrobacterium culture was reached in between 0.6 - 1.0, the culture was centrifuged (10 min at 4,000 rpm at 20°C) and the cells were pellet down. The pellet was again resuspended in 10 - 15 ml (depending on the pellet size) of liquid MS media containing 150 mM acetosyringone (AS). The mature seed-derived calli were then immersed and swirled by hand for 20 min in Agrobacterium suspension, then blotted dry on a filter paper finally transferred to co-cultivation media [MS salts and vitamins, proline 65 mg/l, casein hydrolysate 30 mg/l, 2,4-D 2.5 mg/l, BAP 0.15 mg/l, sucrose 30 g/l, Phytagel gL-1, agarose 2 g/l, acetosyringone 150 mM/l, pH 5.8] and incubated at 26 ± 2°C for 48h in dark. After 48h, the infected calli were washed with sterile distilled water containing 300 mg/l cefotaxime and blotted dry on sterile Whatman paper, then transferred to selection medium [MS salts and vitamins, proline 65 mg/l, casein hydrolysate 30 mg/l, 2,4-D 2.5 mg/l, BAP 0.15 mg/l, sucrose 30 g/l, phytagel 4 g/l, agarose 2 g/l, cefotaxime 300 mg/l, pH 5.8.] containing 50 mg/l hygromycin for 15 days. After 15 days of selection, embryogenic calli were separated and transferred to a fresh selection medium and incubated at 26 ± 2°C in dark. After two rounds of selection (15 days each), the resistant proliferated calli were transferred to regeneration media [MS salts and vitamins, BAP 3 mg/l, NAA 0.5 mg/l, Kn 1 mg/l, sucrose 30 g/l, agarose 2 g/l, pH 5.8.] containing 40 mgL-1 hygromycin and kept in dark for 5 days and transferred to light (16h photoperiod). The regenerated shoots were transferred to rooting media containing MS salts and vitamins, sucrose 20 g/l, phytagel 4 g/l, glucose 10 g/l, pH 5.8. The rooted plants were then transferred to vermiculite pots for hardening. The hardened plants were transferred to soil pots and kept in the greenhouse. The histochemical assay of GUS expression was performed in the leaves of the transformed plants according to the method of Jefferson (1987), using 5-bromo-4-chloro- 3-indolyl glucuronidase (X-gluc) as a substrate. The incubation temperature for this assay was 37ºC. Genomic DNA was extracted from young leaf tissues of transformed and untransformed rice plants by CTAB method. PCR analysis was carried out to confirm the presence of GUS gene in the transformed plant by using GUS specific forward (ATCACCGAATACGGCGTGGA) and reverse (AGGCTGTAGCCGACGATG) primers. The 50µl reaction mixture contained 1µg DNA, 2mM dNTP mixture, 1 µM each of forward and reverse primers and 1 unit of Taq DNA polymerase, and 10× Taq buffer. The condition of the PCR was 98°C for 5 minutes followed by 28 cycles of 94°C for 1 minute, 58°C for 1 minute and 72°C for 1 minute. This was followed by one cycle of 10 minutes at 72°C.