Agricultural Research Management Information System

Home
Research Summary
Search
About Us
- ARMIS
- Brochure
Contact Us
Report
User Request
Data Input
Help
- Operation Manual
  - PDF
  - Video
- Program Area & Commodity
We have reached 37600 number of research entries at this moment.

- Logout

Research Detail

Home
Research
Detail

Bacterial Load and Multi-drug Resistance Patterns of Some Ready-to-eat Street Foods of Dhaka City

MIHIR LAL SAHA
Department of Botany, University of Dhaka, Dhaka- 1000, Bangladesh

MIST. DILARA AKTER
Department of Botany, University of Dhaka, Dhaka- 1000, Bangladesh

TAHSIN KHAN
Department of Botany, University of Dhaka, Dhaka- 1000, Bangladesh

ANEESA ANSARI
Department of Botany, University of Dhaka, Dhaka- 1000, Bangladesh

MOHAMMAD NURUL ISLAM
Department of Botany, University of Dhaka, Dhaka- 1000, Bangladesh

Abstract/ Executive Summary:

Bacterial load and drug resistance pattern associated with some ready-to-eat (RTE) street foods such as Chatpoti, Fuchka, Singara, Panipuri, Ghugni-muri, Chola and water of Dhaka South City Corporation were investigated. Most of the samples were found to be contaminated and the bacterial load ranged from 2.4 × 10⁴ - 9.2 × 10⁶, 1.2 × 10³ - 7.3 × 10⁵ and 1.1 × 10³ - 1.6 × 10⁶ cfu/g of aerobic heterotrophic, coliform bacteria and Staphylococcus, respectively. The highest coliform load (7.3 × 10⁵ cfu/ml) was found in the water of Gulistan. The highest aerobic heterotrophic bacteria (9.2 × 10⁶ cfu/g) and Staphylococcus (1.6 × 10⁶ cfu/g) were observed in the Chatpoti of Nilkhet. Among the isolated 100 different bacterial colonies, 20 Gram-positive and 8 Gram-negative isolates were studied in details. Based on the morphological and biochemical analysis, the Grampositive isolates were identified as Staphylococcus (9), Bacillus (4), Kurthia (3), Planococcus (1), Micrococcus (1), Listeria (1) and Renibacterium (1). Gram-negative isolates were identified as Klebsiella pneumoniae (3), Yersinia pestis (1), Y. pseudotuberculosis (1), Escherichia coli (1), Enterobacter aerogenes (1) and Plesiomonas shigelloides (1). The multi-drug resistance (MDR) pattern was found to be diverse. Among the MDR bacteria, Enterobacter aerogenes was found to be resistant against six common antibiotics. Plesiomonas shigelloides and Yersinia pestis were found to be resistant against five antibiotics. The multiple antibiotic resistant (MAR) indices of Gram-negative isolates ranged in between 22.22 and 66.67%. Conventionally identified five bacterial isolates with significant MAR indices were further identified with 16S rDNA sequencing and found to be as Enterobacter cloaceae Ecl1, Plesiomonas shigelloides CIFRI, Aeromonas sp. TIL_WAK_4, Aeromonas sp. 280 and Klebsiella pneumoniae KPS77. Conventional identification was found to be accurate for three isolates but the two Yersinia sp. were identified to be as Aeromonas sp. in 16S rDNA sequencing.

Keywords: Bacterial load, RTE street foods, Coliform bacteria, MDR, MAR index

Location: Dhaka South City, Bangladesh

Start Date:

End Date:

Program Area: Food Safety and Security

Commodity: Food, Bacteria

Objectives:

To assess the bacterial load and their multi-drug resistance pattern of RTE street foods and water of public rushed areas of Dhaka South City Corporation.

Methodology:

Samples of RTE foods as Chatpoti, Fuchka, Boiled Chola, Ghugni-muri, Panipuri and Singara were collected from nine different populated areas of Dhaka South City Corporation viz. Shahabag, Nilkhet, Gausia market, Polashi, New Market, Chankharpul, Gulistan, Bokshi Bazar and Press Club. Samples were collected in sterile polythene bags and water samples were collected in sterile plastic bottles and brought to the laboratory immediately for bacteriological analysis. Ten g of RTE food samples were taken in a sterile conical flask containing 100 ml of sterile water. In case of water, 1 ml of sample water was added in sterile conical flask containing 99 ml sterile water. Bacterial load of the samples was then measured by tenfolds serial dilution technique(9). Nutrient agar (NA) medium was used for aerobic heterotrophic bacteria while MacConkey agar (Scharlau Chemie, Japan) and Mannitol Salt Agar (MSA) (Oxoid) were used for coliform bacteria and Staphylococcus sp., respectively. The plates were incubated at 37°C in an incubator (Memmert GmbH + Co Kg 8540 Sehwabach) for 24 hrs. After incubation, the well discrete colonies were counted by a colony counter (DC-8 OSK 100086, Kayagaki, Japan). Important physiological and biochemical tests were carried out and conventional identifications of the isolates were made following standard laboratory manuals(10-13). Antibiotic susceptibility test was performed by the Kirby-Bauer disc diffusion method. on Mueller-Hinton agar. Zone diameter around the discs was measured and the isolates were classified as susceptible (S), intermediately resistant (I) and resistant (R). Nine antibiotics viz., cefuroxime (CXM 30μg), neomycin (NEO 30μg), gentamycin (GEN 10μg), kanamycin (KAN 30μg), doxycycline (DOX 30μg), ciprofloxacin (CIP 5μg), rifampicin (RIF 5μg), erythromycin (ERY 15μg) and chloramphenicol (CHL 30μg) were tested. Multiple antibiotic resistance (MAR) index % of the isolates was determined using the following formula MAR index % = {(No. of antibiotics to which pathogen showed resistance) / (No. of antibiotics used)} x 100. Molecular identification of MDR bacterial strains was conducted based on 16S rDNA sequence analysis. The following primer pairs - 5'-16S rRNA: CCAGACTCCTACGGG AGGCAGC, 3'-16S rRNA: CTTGTGCGGGCCCCCGTCAATTC were used to amplify a part (~600 bp) of the rRNA gene. The supernatant of heat lysed cell suspension was used as the source of template DNA for PCR amplification following protocol as described in our previous work(16). The amplified products were separated electrophoretically on 1% agarose gel. DNA bands were observed on UV-transilluminator and photographed by a gel documentation system (Microdoc DI-HD, MUV21-254/365, Cleaver Scientific). The sequence generated from automated sequencing of PCR products were analyzed through the NCBI-BLAST database (http://blast.ncbi.nlm.nih.gov/) and rRNA BLAST (http://bioinformatics. psb.ugent.be/cgi-bin/rRNA/blastform.cgi) programs to find out possible similar organisms in the data bases. The data were analyzed to determine the descriptive
statistics viz. statistical mean and standard deviation (Sd) with SPSS v.16.0 for windows (SPSS, SAS Institute Inc. Cary, USA).

Source of Information: Dhaka Univ. J. Biol. Sci. 27(1): 27-36, 2018 (January)

Article Link (Online Journal):

Funding Source:

Budget:

Total Budget (Tk.) :

Achievement/Findings:

The aerobic heterotrophic bacterial load of the samples ranged between 2.4 × 10⁴ and 9.2 × 10⁶ cfu/g. Maximum heterotrophic bacterial count (9.2 × 10⁶ cfu/g) was observed in the Chatpoti of Nilkhet. The coliform and staphylococcal bacterial load of the samples ranged from 1.2 × 10³ to 7.3 × 10⁵ and 1.1 × 10³ to 1.6 × 10⁶ cfu/g, respectively. The highest coliform load (7.3 × 10⁵ cfu/ml) was found in the water sample of Gulistan and highest Staphylococcus (1.6 × 10⁶ cfu/g) was observed in the Chatpoti of Nilkhet. Similar findings were also observed by other workers(17-20). In most cases, potable water supply was not available to the vendors and thus hand and dish washing are usually done in one and same bucket. Considering coliform contamination, the water of the RTE food shops was not safe for drinking. Vendors usually prepare and serve the food in bare and unwashed hands which could be the most probable sources of contamination(6). The use of raw vegetables viz. cucumber, tomato, carrot, onion, green chili, tamarind and coriander leaf samples also contribute to the bacterial load. The contamination may originate also from the utensils or through transportation. Among the MDR bacteria, Enterobacter aerogenes was found to be resistant against six common antibiotics. Plesiomonas shigelloides and Yersinia pestis were found to be resistant against five antibiotics. The multiple antibiotic resistant (MAR) indices of Gram-negative isolates ranged in between 22.22 and 66.67%. Conventionally identified five bacterial isolates with significant MAR indices were further identified with 16S rDNA sequencing and found to be as Enterobacter cloaceae Ecl1, Plesiomonas shigelloides CIFRI, Aeromonas sp. TIL_WAK_4, Aeromonas sp. 280 and Klebsiella pneumoniae KPS77. Conventional identification was found to be accurate for three isolates but the two Yersinia sp. were identified to be as Aeromonas sp. in 16S rDNA sequencing.

Knowledge Management: Journal